GRIA4 (NM_001112812) Human Untagged Clone

CAT#: SC318875

GRIA4 (untagged)-Human glutamate receptor, ionotrophic, AMPA 4 (GRIA4), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GRIA4
• Synonyms: GluA4; GLUR4; GLUR4C; GLURD; NEDSGA
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001112812, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGGATTATTTCCAGACAGATTGTCTTGTTATTTTCTGGATTTTGGGGACTCGCCATGGGAGCCTTTC
  CGAGCAGCGTGCAAATAGGTGGTCTCTTCATCCGAAACACAGATCAGGAATACACTGCTTTTCGATTAGC
  AATTTTTCTTCATAACACCAGCCCCAATGCGTCGGAAGCTCCTTTTAATTTGGTACCTCATGTGGACAAC
  ATTGAGACAGCCAACAGTTTTGCTGTAACAAACGCCTTCTGTTCCCAGTATTCTAGAGGAGTATTTGCCA
  TTTTTGGACTCTATGATAAGAGGTCGGTACATACCTTGACCTCATTCTGCAGCGCCTTACATATCTCCCT
  CATCACACCAAGTTTCCCTACTGAGGGGGAGAGCCAGTTTGTGCTGCAACTAAGACCTTCGTTACGAGGA
  GCACTCTTGAGTTTGCTGGATCACTACGAATGGAACTGTTTTGTCTTCCTGTATGACACAGACAGGGGAT
  ACTCGATACTCCAAGCTATTATGGAAAAAGCAGGACAAAATGGTTGGCATGTCAGCGCTATATGTGTGGA
  AAATTTTAATGATGTCAGCTATAGGCAACTTCTAGAAGAACTTGACAGAAGACAAGAGAAGAAGTTTGTA
  ATAGACTGTGAGATAGAGAGACTTCAAAACATATTAGAACAGATTGTAAGTGTTGGAAAGCATGTTAAAG
  GCTACCATTATATCATTGCAAACTTGGGATTCAAGGATATTTCTCTTGAGAGGTTTATACATGGTGGAGC
  CAATGTTACTGGATTCCAGTTGGTGGATTTTAATACACCTATGGTAATCAAACTAATGGATCGCTGGAAG
  AAACTAGATCAGAGAGAGTATCCAGGATCTGAGACTCCTCCAAAGTACACCTCTGCTCTGACTTATGATG
  GAGTCCTTGTGATGGCTGAAACTTTCCGAAGTCTTAGGAGGCAGAAAATTGATATCTCAAGGAGAGGAAA
  TGCTGGGGATTGTCTGGCAAATCCTGCTGCTCCATGGGGCCAGGGAATTGACATGGAGAGGACACTCAAA
  CAGGTTCGAATTCAAGGGCTGACAGGGAATGTTCAGTTTGACCACTATGGACGTAGAGTCAATTACACAA
  TGGATGTGTTTGAGCTGAAAAGCACAGGACCTAGAAAGGTTGGTTACTGGAATGATATGGATAAGTTAGT
  CTTGATTCAAGATGTACCAACTCTTGGCAATGACACAGCTGCTATTGAGAACAGAACAGTGGTTGTAACC
  ACAATTATGCCTCTGATGAAGAATCCTATTTTAAGAAATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001112812
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001112812.1, NP_001106283.1
• RefSeq Size: 3213 bp
• RefSeq ORF: 1302 bp
• Locus ID: 2893
• Cytogenetics: 11q22.3
• Protein Families: Druggable Genome, Ion Channels: Glutamate Receptors, Transmembrane
• Protein Pathways: Neuroactive ligand-receptor interaction
• Gene Summary: 'Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. Some haplotypes of this gene show a positive association with schizophrenia. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (4) is missing a 5' non-coding exon and several coding exons at the 3' end, and contains a novel 3' terminal exon compared to transcript variant 1. This results in a shorter isoform (3) with a different C-terminus compared to isoform 1. Variants 3 and 4 have different 5' UTR, but encode the same isoform.