IRAK4 (NM_001114182) Human Untagged Clone
CAT#: SC318891
IRAK4 (untagged)-Human interleukin-1 receptor-associated kinase 4 (IRAK4), transcript variant 1
"NM_001114182" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IRAK4 |
Synonyms | IPD1; IRAK-4; NY-REN-64; REN64 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001114182, the custom clone sequence may differ by one or more nucleotides
ATGAACAAACCCATAACACCATCAACATATGTGCGCTGCCTCAATGTTGGACTAATTAGGAAGCTGTCAG ATTTTATTGATCCTCAAGAAGGATGGAAGAAGTTAGCTGTAGCTATTAAAAAACCATCTGGTGATGATAG ATACAATCAGTTTCACATAAGGAGATTTGAAGCATTACTTCAAACTGGAAAAAGTCCCACTTCTGAATTA CTGTTTGACTGGGGCACCACAAATTGCACAGTTGGTGATCTTGTGGATCTTTTGATCCAAAATGAATTTT TTGCTCCTGCGAGTCTTTTGCTCCCAGATGCTGTTCCCAAAACTGCTAATACACTACCTTCTAAAGAAGC TATAACAGTTCAGCAAAAACAGATGCCTTTCTGTGACAAAGACAGGACATTGATGACACCTGTGCAGAAT CTTGAACAAAGCTATATGCCACCTGACTCCTCAAGTCCAGAAAATAAAAGTTTAGAAGTTAGTGATACAC GTTTTCACAGTTTTTCATTTTATGAATTGAAGAATGTCACAAATAACTTTGATGAACGACCCATTTCTGT TGGTGGTAATAAAATGGGAGAGGGAGGATTTGGAGTTGTATATAAAGGCTACGTAAATAACACAACTGTG GCAGTGAAGAAGCTTGCAGCAATGGTTGACATTACTACTGAAGAACTGAAACAGCAGTTTGATCAAGAAA TAAAAGTAATGGCAAAGTGTCAACATGAAAACTTAGTAGAACTACTTGGTTTCTCAAGTGATGGAGATGA CCTCTGCTTAGTATATGTTTACATGCCTAATGGTTCATTGCTAGACAGACTCTCTTGCTTGGATGGTACT CCACCACTTTCTTGGCACATGAGATGCAAGATTGCTCAGGGTGCAGCTAATGGCATCAATTTTCTACATG AAAATCATCATATTCATAGAGATATTAAAAGTGCAAATATCTTACTGGATGAAGCTTTTACTGCTAAAAT ATCTGACTTTGGCCTTGCACGGGCTTCTGAGAAGTTTGCCCAGACAGTCATGACTAGCAGAATTGTGGGA ACAACAGCTTATATGGCACCAGAAGCTTTGCGTGGAGAAATAACACCCAAATCTGATATTTACAGCTTTG GTGTGGTTTTACTAGAAATAATAACTGGACTTCCAGCTGTGGATGAACACCGTGAACCTCAGTTATTGCT AGATATTAAAGAAGAAATTGAAGATGAAGAAAAGACAATTGAAGATTATATTGATAAAAAGATGAATGAT GCTGATTCCACTTCAGTTGAAGCTATGTACTCTGTTGCTAGTCAATGTCTGCATGAAAAGAAAAATAAGA GACCAGACATTAAGAAGGTTCAACAGCTGCTGCAAGAGATGACAGCTTCTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_001114182 |
ORF Size | 1383 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001114182.2, NP_001107654.1 |
RefSeq Size | 4351 |
RefSeq ORF | 1383 |
Locus ID | 51135 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Apoptosis, Neurotrophin signaling pathway, Toll-like receptor signaling pathway |
Gene Summary | This gene encodes a kinase that activates NF-kappaB in both the Toll-like receptor (TLR) and T-cell receptor (TCR) signaling pathways. The protein is essential for most innate immune responses. Mutations in this gene result in IRAK4 deficiency and recurrent invasive pneumococcal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (1) encodes the longest isoform (a). Variants 1, 2, and 13 all encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225772 | IRAK4 (Myc-DDK-tagged)-Human interleukin-1 receptor-associated kinase 4 (IRAK4), transcript variant 1 |
USD 420.00 |
|
RG225772 | IRAK4 (GFP-tagged) - Human interleukin-1 receptor-associated kinase 4 (IRAK4), transcript variant 1 |
USD 460.00 |
|
RC225772L1 | Lenti ORF clone of Human interleukin-1 receptor-associated kinase 4 (IRAK4), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC225772L2 | Lenti ORF clone of Human interleukin-1 receptor-associated kinase 4 (IRAK4), transcript variant 1, mGFP tagged |
USD 768.00 |
|
RC225772L3 | Lenti ORF clone of Human interleukin-1 receptor-associated kinase 4 (IRAK4), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC225772L4 | Lenti ORF clone of Human interleukin-1 receptor-associated kinase 4 (IRAK4), transcript variant 1, mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review