ENTPD6 (NM_001114089) Human Untagged Clone

CAT#: SC318897

ENTPD6 (untagged)-Human ectonucleoside triphosphate diphosphohydrolase 6 (putative) (ENTPD6), transcript variant 2


  "NM_001114089" in other vectors (4)

Reconstitution Protocol

USD 780.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ENTPD6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ENTPD6
Synonyms CD39L2; dJ738P15.3; IL-6SAG; IL6ST2; NTPDase-6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001114089, the custom clone sequence may differ by one or more nucleotides


ATGCAGCCGCAGCACGGTCCTTGGCAAACAAGGATGAGAAAAATATCCAACCACGGGAGCCTGCGGGTGG
CGAAGGTGGCATACCCCCTGGGGCTGTGTGTGGGCGTGTTCATCTATGTTGCCTACATCAAGTGGCACCG
GGCCACCGCCACCCAGGCCTTCTTCAGCATCACCAGGGCAGCCCCGGGGGCCCGGTGGGGTCAGCAGGCC
CACAGCCCCCTGGGGACAGCTGCAGACGGGCACGAGGTCTTCTACGGGATCATGTTTGATGCAGGAAGCA
CTGGCACCCGAGTACACGTCTTCCAGTTCACCCGGCCCCCCAGAGAAACTCCCACGTTAACCCACGAAAC
CTTCAAAGCACTGAAGCCAGGTCTTTCTGCCTATGCTGATGATGTTGAAAAGAGCGCTCAGGGAATCCGG
GAACTACTGGATGTTGCTAAACAGGACATTCCGTTCGACTTCTGGAAGGCCACCCCTCTGGTCCTCAAGG
CCACAGCTGGCTTACGCCTGTTACCTGGAGAAAAGGCCCAGAAGTTACTGCAGAAGGTGAAAGAAGTATT
TAAAGCATCGCCTTTCCTTGTAGGGGATGACTGTGTTTCCATCATGAACGGAACAGATGAAGGCGTTTCG
GCGTGGATCACCATCAACTTCCTGACAGGCAGCTTGAAAACTCCAGGAGGGAGCAGCGTGGGCATGCTGG
ACTTGGGCGGAGGATCCACTCAGATCGCCTTCCTGCCACGCGTGGAGGGCACCCTGCAGGCCTCCCCACC
CGGCTACCTGACGGCACTGCGGATGTTTAACAGGACCTACAAGCTCTATTCCTACAGCTACCTCGGGCTC
GGGCTGATGTCGGCACGCCTGGCGATCCTGGGCGGCGTGGAGGGGCAGCCTGCTAAGGATGGAAAGGAGT
TGGTCAGCCCTTGCTTGTCTCCCAGTTTCAAAGGAGAGTGGGAACACGCAGAAGTCACGTACAGGGTTTC
AGGGCAGAAAGCAGCGGCAAGCCTGCACGAGCTGTGTGCTGCCAGAGTGTCAGAGGTCCTTCAAAACAGA
GTGCACAGGACGGAGGAAGTGAAGCATGTGGACTTCTATGCTTTCTCCTACTATTACGACCTTGCAGCTG
GTGTGGGCCTCATAGATGCGGAGAAGGGAGGCAGCCTGGTGGTGGGGGACTTCGAGATCGCAGCCAAGTA
CGTGTGTCGGACCCTGGAGACACAGCCGCAGAGCAGCCCCTTCTCATGCATGGACCTCACCTACGTCAGC
CTGCTACTCCAGGAGTTCGGCTTTCCCAGGAGCAAAGTGCTGAAGCTCACTCGGAAAATTGACAATGTTG
AGACCAGCTGGGCTCTGGGGGCCATTTTTCATTACATCGACTCCCTGAACAGACAGAAGAGTCCAGCCTC
ATAG


Restriction Sites SgfI-RsrII     
ACCN NM_001114089
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001114089.3, NP_001107561.1
RefSeq Size 4092 bp
RefSeq ORF 1404 bp
Locus ID 955
Cytogenetics 20p11.21
Protein Families Secreted Protein, Transmembrane
Protein Pathways Purine metabolism, Pyrimidine metabolism
Gene Summary 'ENTPD6 is similar to E-type nucleotidases (NTPases). NTPases, such as CD39, mediate catabolism of extracellular nucleotides. ENTPD6 contains 4 apyrase-conserved regions which are characteristic of NTPases. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]'
Transcript Variant: This variant (2) lacks an internal exon in the 5' region, resulting in a distinct 5' UTR and the use of an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus, and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.