Angiopoietin 2 (ANGPT2) (NM_001118887) Human Untagged Clone

CAT#: SC318914

ANGPT2 (untagged)-Human angiopoietin 2 (ANGPT2), transcript variant 2


  "NM_001118887" in other vectors (4)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "ANGPT2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ANGPT2
Synonyms AGPT2; ANG2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001118887 edited
ATGTGGCAGATTGTTTTCTTTACTCTGAGCTGTGATCTTGTCTTGGCCGCAGCCTATAAC
AACTTTCGGAAGAGCATGGACAGCATAGGAAAGAAGCAATATCAGGTCCAGCATGGGTCC
TGCAGCTACACTTTCCTCCTGCCAGAGATGGACAACTGCCGCTCTTCCTCCAGCCCCTAC
GTGTCCAATGCTGTGCAGAGGGACGCGCCGCTCGAATACGATGACTCGGTGCAGAGGCTG
CAAGTGCTGGAGAACATCATGGAAAACAACACTCAGTGGCTAATGAAGCTTGAGAATTAT
ATCCAGGACAACATGAAGAAAGAAATGGTAGAGATACAGCAGAATGCAGTACAGAACCAG
ACGGCTGTGATGATAGAAATAGGGACAAACCTGTTGAACCAAACAGCGGAGCAAACGCGG
AAGTTAACTGATGTGGAAGCCCAAGTATTAAATCAGACCACGAGACTTGAACTTCAGCTC
TTGGAACACTCCCTCTCGACAAACAAATTGGAAAAACAGATTTTGGACCAGACCAGTGAA
ATAAACAAATTGCAAGATAAGAACAGTTTCCTAGAAAAGAAGGTGCTAGCTATGGAAGAC
AAGCACATCATCCAACTACAGTCAATAAAAGAAGAGAAAGATCAGCTACAGGTGTTAGTA
TCCAAGCAAAATTCCATCATTGAAGAACTAGAAAAAAAAATAGTGACTGCCACGGTGAAT
AATTCAGTTCTTCAGAAGCAGCAACATGATCTCATGGAGACAGTTAATAACTTACTGACT
ATGATGTCCACATCAAACTCTAAGGACCCCACTGTTGCTAAAGAAGAACAAATCAGCTTC
AGAGACTGTGCTGAAGTATTCAAATCAGGACACACCACGAATGGCATCTACACGTTAACA
TTCCCTAATTCTACAGAAGAGATCAAGGCCTACTGTGACATGGAAGCTGGAGGAGGCGGG
TGGACAATTATTCAGCGACGTGAGGATGGCAGCGTTGATTTTCAGAGGACTTGGAAAGAA
TATAAAGTGGGATTTGGTAACCCTTCAGGAGAATATTGGCTGGGAAATGAGTTTGTTTCG
CAACTGACTAATCAGCAACGCTATGTGCTTAAAATACACCTTAAAGACTGGGAAGGGAAT
GAGGCTTACTCATTGTATGAACATTTCTATCTCTCAAGTGAAGAACTCAATTATAGGATT
CACCTTAAAGGACTTACAGGGACAGCCGGCAAAATAAGCAGCATCAGCCAACCAGGAAAT
GATTTTAGCACAAAGGATGGAGACAACGACAAATGTATTTGCAAATGTTCACAAATGCTA
ACAGGAGGCTGGTGGTTTGATGCATGTGGTCCTTCCAACTTGAACGGAATGTACTATCCA
CAGAGGCAGAACACAAATAAGTTCAACGGCATTAAATGGTACTACTGGAAAGGCTCAGGC
TATTCGCTCAAGGCCACAACCATGATGATCCGACCAGCAGATTTCTAA
Restriction Sites Please inquire     
ACCN NM_001118887
Insert Size 2500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001118887.1, NP_001112359.1
RefSeq Size 5267 bp
RefSeq ORF 1488 bp
Locus ID 285
Cytogenetics 8p23.1
Protein Families Druggable Genome, Secreted Protein
Gene Summary 'This gene belongs to the angiopoietin family of growth factors. The protein encoded by this gene is an antagonist of angiopoietin 1, and both angiopoietin 1 and angiopoietin 2 are ligands for the endothelial TEK receptor tyrosine kinase. Angiopoietin 2 is upregulated in multiple inflammatory diseases and is implicated in the direct control of inflammation-related signaling pathways. The encoded protein affects angiogenesis during embryogenesis and tumorigenesis, disrupts the vascular remodeling ability of angiopoietin 1, and may induce endothelial cell apoptosis. This gene serves a prognostic biomarker for acute respiratory distress syndrome. [provided by RefSeq, Aug 2020]'
Transcript Variant: This variant (2) uses an alternate in-frame splice site compared to variant 1, resulting in an isoform (b) that lacks an internal aa compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.