PLAUR (NM_002659) Human Untagged Clone
CAT#: SC319092
PLAUR (untagged)-Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 1
"NM_002659" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PLAUR |
Synonyms | CD87; U-PAR; UPAR; URKR |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002659.2
CCTTCCTGAGGCCAGAAGGAGAGAAGACGTGCAGGGACCCCGCGCACAGGAGCTGCCCTC
GCGACATGGGTCACCCGCCGCTGCTGCCGCTGCTGCTGCTGCTCCACACCTGCGTCCCAG CCTCTTGGGGCCTGCGGTGCATGCAGTGTAAGACCAACGGGGATTGCCGTGTGGAAGAGT GCGCCCTGGGACAGGACCTCTGCAGGACCACGATCGTGCGCTTGTGGGAAGAAGGAGAAG AGCTGGAGCTGGTGGAGAAAAGCTGTACCCACTCAGAGAAGACCAACAGGACCCTGAGCT ATCGGACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCA ACCAGGGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTT CCTGTGGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCA GCCCTGAAGAACAGTGCCTGGATGTGGTGACCCACTGGATCCAGGAAGGTGAAGAAGGGC GTCCAAAGGATGACCGCCACCTCCGTGGCTGTGGCTACCTTCCCGGCTGCCCGGGCTCCA ATGGTTTCCACAACAACGACACCTTCCACTTCCTGAAATGCTGCAACACCACCAAATGCA ACGAGGGCCCAATCCTGGAGCTTGAAAATCTGCCGCAGAATGGCCGCCAGTGTTACAGCT GCAAGGGGAACAGCACCCATGGATGCTCCTCTGAAGAGACTTTCCTCATTGACTGCCGAG GCCCCATGAATCAATGTCTGGTAGCCACCGGCACTCACGAACCGAAAAACCAAAGCTATA TGGTAAGAGGCTGTGCAACCGCCTCAATGTGCCAACATGCCCACCTGGGTGACGCCTTCA GCATGAACCACATTGATGTCTCCTGCTGTACTAAAAGTGGCTGTAACCACCCAGACCTGG ATGTCCAGTACCGCAGTGGGGCTGCTCCTCAGCCTGGCCCTGCCCATCTCAGCCTCACCA TCACCCTGCTAATGACTGCCAGACTGTGGGGAGGCACTCTCCTCTGGACCTAAACCTGAA ATCCCCCTCTCTGCCCTGGCTGGATCCGGGGGACCCCTTTGCCCTTCCCTCGGCTCCCAG CCCTACAGACTTGCTGTGTGACCTCAGGCCAGTGTGCCGACCTCTCTGGGCCTCAGTTTT CCCAGCTATGAAAACAGCTATCTCACAAAGTTGTGTGAAGCAGAAGAGAAAAGCTGGAGG AAGGCCGTGGGCCAATGGGAGAGCTCTTGTTATTATTAATATTGTTGCCGCTGTTGTGTT GTTGTTATTAATTAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002659 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002659.2, NP_002650.1 |
RefSeq Size | 1548 bp |
RefSeq ORF | 1008 bp |
Locus ID | 5329 |
Cytogenetics | 19q13.31 |
Domains | LU |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Complement and coagulation cascades |
Gene Summary | 'This gene encodes the receptor for urokinase plasminogen activator and, given its role in localizing and promoting plasmin formation, likely influences many normal and pathological processes related to cell-surface plasminogen activation and localized degradation of the extracellular matrix. It binds both the proprotein and mature forms of urokinase plasminogen activator and permits the activation of the receptor-bound pro-enzyme by plasmin. The protein lacks transmembrane or cytoplasmic domains and may be anchored to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) moiety following cleavage of the nascent polypeptide near its carboxy-terminus. However, a soluble protein is also produced in some cell types. Alternative splicing results in multiple transcript variants encoding different isoforms. The proprotein experiences several post-translational cleavage reactions that have not yet been fully defined. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) encodes the longest isoform (1) which contains three LU (Ly-6 antigen/uPA receptor-like) domains. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201222 | PLAUR (Myc-DDK-tagged)-Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 1 |
USD 420.00 |
|
RG201222 | PLAUR (GFP-tagged) - Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 1 |
USD 460.00 |
|
RC201222L1 | Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC201222L2 | Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 1, mGFP tagged |
USD 768.00 |
|
RC201222L3 | Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC201222L4 | Lenti ORF clone of Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 1, mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review