PPP1A (PPP1CA) (NM_002708) Human Untagged Clone
CAT#: SC319185
PPP1CA (untagged)-Human protein phosphatase 1, catalytic subunit, alpha isozyme (PPP1CA), transcript variant 1
"NM_002708" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | PPP1CA |
| Synonyms | PP-1A; PP1A; PP1alpha; PPP1A |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_002708.3
GGCTGCCGGAGGGCGGGAGGCAGGAGCGGGCCAGGAGCTGCTGGGCTGGAGCGGCGGCGC
CGCCATGTCCGACAGCGAGAAGCTCAACCTGGACTCGATCATCGGGCGCCTGCTGGAAGT GCAGGGCTCGCGGCCTGGCAAGAATGTACAGCTGACAGAGAACGAGATCCGCGGTCTGTG CCTGAAATCCCGGGAGATTTTTCTGAGCCAGCCCATTCTTCTGGAGCTGGAGGCACCCCT CAAGATCTGCGGTGACATACACGGCCAGTACTACGACCTTCTGCGACTATTTGAGTATGG CGGTTTCCCTCCCGAGAGCAACTACCTCTTTCTGGGGGACTATGTGGACAGGGGCAAGCA GTCCTTGGAGACCATCTGCCTGCTGCTGGCCTATAAGATCAAGTACCCCGAGAACTTCTT CCTGCTCCGTGGGAACCACGAGTGTGCCAGCATCAACCGCATCTATGGTTTCTACGATGA GTGCAAGAGACGCTACAACATCAAACTGTGGAAAACCTTCACTGACTGCTTCAACTGCCT GCCCATCGCGGCCATAGTGGACGAAAAGATCTTCTGCTGCCACGGAGGCCTGTCCCCGGA CCTGCAGTCTATGGAGCAGATTCGGCGGATCATGCGGCCCACAGATGTGCCTGACCAGGG CCTGCTGTGTGACCTGCTGTGGTCTGACCCTGACAAGGACGTGCAGGGCTGGGGCGAGAA CGACCGTGGCGTCTCTTTTACCTTTGGAGCCGAGGTGGTGGCCAAGTTCCTCCACAAGCA CGACTTGGACCTCATCTGCCGAGCACACCAGGTGGTAGAAGACGGCTACGAGTTCTTTGC CAAGCGGCAGCTGGTGACACTTTTCTCAGCTCCCAACTACTGTGGCGAGTTTGACAATGC TGGCGCCATGATGAGTGTGGACGAGACCCTCATGTGCTCTTTCCAGATCCTCAAGCCCGC CGACAAGAACAAGGGGAAGTACGGGCAGTTCAGTGGCCTGAACCCTGGAGGCCGACCCAT CACCCCACCCCGCAATTCCGCCAAAGCCAAGAAATAGCCCCCGCACACCACCCTGTGCCC CAGATGATGGATTGATTGTACAGAAATCATGCTGCCATGCTGGGGGGGGGTCACCCCGAC CCCTCAGGCCCACCTGTCACGGGGAACATGGAGCCTTGGTGTATTTTTCTTTTCTTTTTT TAATGAATCAATAGCAGCGTCCAGTCCCCCAGGGCTGCTTCCTGCCTGCACCTGCGGTGA CTGTGAGCAGGATCCTGGGGCCGAGGCTGCAGCTCAGGGCAACGGCAGGCCAGGTCGTGG GTCTCCAGCCGTGCTTGGCCTCAGGGCTGGCAGCCGGATCCTGGGGCAACCCATCTGGTC TCTTGAATAAAGGTCAAAGCTGGATTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_002708 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_002708.3, NP_002699.1 |
| RefSeq Size | 1488 bp |
| RefSeq ORF | 993 bp |
| Locus ID | 5499 |
| Cytogenetics | 11q13.2 |
| Domains | Metallophos, PP2Ac |
| Protein Families | Druggable Genome, Phosphatase |
| Protein Pathways | Focal adhesion, Insulin signaling pathway, Long-term potentiation, Oocyte meiosis, Regulation of actin cytoskeleton, Vascular smooth muscle contraction |
| Gene Summary | 'The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). This broadly expressed gene encodes the alpha subunit of the PP1 complex that associates with over 200 regulatory proteins to form holoenzymes which dephosphorylate their biological targets with high specificity. PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies suggest that PP1 is an important regulator of cardiac function and that PP1 deregulation is implicated in diabetes and multiple types of cancer. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2020]' Transcript Variant: This variant (1) represents the predominant transcript and encodes isoform 1. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203575 | PPP1CA (Myc-DDK-tagged)-Human protein phosphatase 1, catalytic subunit, alpha isozyme (PPP1CA), transcript variant 1 |
USD 300.00 |
|
| RG203575 | PPP1CA (GFP-tagged) - Human protein phosphatase 1, catalytic subunit, alpha isozyme (PPP1CA), transcript variant 1 |
USD 460.00 |
|
| RC203575L1 | Lenti ORF clone of Human protein phosphatase 1, catalytic subunit, alpha isozyme (PPP1CA), transcript variant 1, Myc-DDK-tagged |
USD 600.00 |
|
| RC203575L2 | Lenti ORF clone of Human protein phosphatase 1, catalytic subunit, alpha isozyme (PPP1CA), transcript variant 1, mGFP tagged |
USD 600.00 |
|
| RC203575L3 | Lenti ORF clone of Human protein phosphatase 1, catalytic subunit, alpha isozyme (PPP1CA), transcript variant 1, Myc-DDK-tagged |
USD 600.00 |
|
| RC203575L4 | Lenti ORF clone of Human protein phosphatase 1, catalytic subunit, alpha isozyme (PPP1CA), transcript variant 1, mGFP tagged |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China