Tropomyosin 3 (TPM3) (NM_152263) Human Untagged Clone

CAT#: SC319334

TPM3 (untagged)-Human tropomyosin 3 (TPM3), transcript variant 1


  "NM_152263" in other vectors (7)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TPM3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TPM3
Synonyms CAPM1; CFTD; HEL-189; HEL-S-82p; hscp30; NEM1; OK/SW-cl.5; TM-5; TM3; TM5; TM30; TM30nm; TPM3nu; TPMsk3; TRK
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_152263 edited
GGTCACTCAGGCAGCAGCCCCTTCTTTCTTGCCCCAGTCTCCAGTTCTCCAGTGTTCACA
GGTGAGCCTACCAACAGCCACTGCTCATGATGGAGGCCATCAAGAAAAAGATGCAGATGC
TGAAGTTAGACAAGGAGAATGCTCTGGATCGGGCAGAGCAAGCTGAAGCTGAGCAGAAGC
AGGCAGAAGAAAGAAGTAAACAGCTGGAGGATGAGCTGGCAGCCATGCAGAAGAAGCTGA
AAGGGACAGAGGATGAGCTGGACAAGTATTCTGAAGCTTTGAAGGATGCCCAGGAGAAGC
TGGAACTGGCAGAGAAGAAGGCTGCTGATGCTGAGGCTGAGGTGGCCTCCTTGAACCGTA
GGATCCAGCTGGTTGAAGAAGAGCTGGACCGTGCTCAGGAGCGCCTGGCCACTGCCCTGC
AAAAGCTGGAAGAAGCTGAAAAAGCTGCTGATGAGAGTGAGAGAGGTATGAAGGTTATTG
AAAACCGGGCCTTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAACTCAAAGAAG
CTAAGCACATTGCAGAAGAGGCAGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGA
TCATTGAAGGAGACTTGGAACGCACAGAGGAACGAGCTGAGCTGGCAGAGTCTAAGTGTT
CTGAGCTGGAGGAGGAGCTGAAGAATGTCACCAACAACCTCAAGTCTCTTGAGGCTCAGG
CGGAGAAGTACTCTCAAAAAGAAGATAAATATGAGGAAGAAATCAAGATTCTTACTGATA
AACTCAAGGAGGCAGAGACCCGTGCTGAGTTTGCTGAGAGATCGGTAGCCAAGCTGGAAA
AGACAATTGATGACCTGGAAGATGAGCTCTATGCCCAGAAACTGAAGTACAAGGCCATTA
GCGAGGAGCTGGACCACGCCCTCAATGACATGACCTCTATATAATTATCACCGTTTCTGC
TCTGTTCTGGATCTGCCCCCTTTACTCCTCGGGGAACCCAAGGCCCCACTCTCGCTCTGG
ATTCCATTTGGGTCAGCCTGGCTGGTCCCCAAGGCATTAGGATGGGGGAGCAAAAAGCAA
CTTATGTATTTTCTTCCACCCCCACCCCAAATTAAAATGTTAAGCTGCCAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_152263
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_152263.2, NP_689476.2
RefSeq Size 7116 bp
RefSeq ORF 858 bp
Locus ID 7170
Cytogenetics 1q21.3
Domains Tropomyosin
Protein Pathways Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), Pathways in cancer, Thyroid cancer
Gene Summary 'This gene encodes a member of the tropomyosin family of actin-binding proteins. Tropomyosins are dimers of coiled-coil proteins that provide stability to actin filaments and regulate access of other actin-binding proteins. Mutations in this gene result in autosomal dominant nemaline myopathy and other muscle disorders. This locus is involved in translocations with other loci, including anaplastic lymphoma receptor tyrosine kinase (ALK) and neurotrophic tyrosine kinase receptor type 1 (NTRK1), which result in the formation of fusion proteins that act as oncogenes. There are numerous pseudogenes for this gene on different chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]'
Transcript Variant: This variant (Tpm3.12, also known as variant 1) differs in the 5' and 3' UTRs and contains multiple differences in the coding region, compared to variant Tpm3.1. It represents use of an alternate promoter and initiates translation at an alternate start codon. The encoded isoform (Tpm3.12st, also known as Tm sk alpha-slow, alpha s Tm1, or isoform 1) is longer and has distinct N- and C- termini, compared to isoform Tpm3.1cy. Expression of the encoded isoform is enriched in slow-twitch skeletal muscle. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.