SKP2 (NM_032637) Human Untagged Clone

CAT#: SC319362

SKP2 (untagged)-Human S-phase kinase-associated protein 2 (p45) (SKP2), transcript variant 2


  "NM_032637" in other vectors (4)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "SKP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SKP2
Synonyms FBL1; FBXL1; FLB1; p45
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_032637.2 CGTTGCTAGGCTTAGCGGGTCTGGCTGCTGGGGGCCCGAGCAGCACGCTCGGAGCCGCCG
CGCGCCAAAGCGGGAATCTGGGAGGCGAGCAGCTCTGCAGTTAATGCACGTATTTTAAAC
TCCCGGGCCTGCGGACGCTATGCACAGGAAGCACCTCCAGGAGATTCCAGACCTGAGTAG
CAACGTTGCCACCAGCTTCACGTGGGGATGGGATTCCAGCAAGACTTCTGAACTGCTGTC
AGGCATGGGGGTCTCCGCCCTGGAGAAAGAGGAGCCCGACAGTGAGAACATCCCCCAGGA
ACTGCTCTCAAACCTGGGCCACCCGGAGAGCCCCCCACGGAAACGGCTGAAGAGCAAAGG
GAGTGACAAAGACTTTGTGATTGTCCGCAGGCCTAAGCTAAATCGAGAGAACTTTCCAGG
TGTTTCATGGGACTCCCTTCCGGATGAGCTGCTCTTGGGAATCTTTTCCTGTCTGTGCCT
CCCTGAGCTGCTAAAGGTCTCTGGTGTTTGTAAGAGGTGGTATCGCCTAGCGTCTGATGA
GTCTCTATGGCAGACCTTAGACCTCACAGGTAAAAATCTGCACCCGGATGTGACTGGTCG
GTTGCTGTCTCAAGGGGTGATTGCCTTCCGCTGCCCACGATCATTTATGGACCAACCATT
GGCTGAACATTTCAGCCCTTTTCGTGTACAGCACATGGACCTATCGAACTCAGTTATAGA
AGTGTCCACCCTCCACGGCATACTGTCTCAGTGTTCCAAGTTGCAGAATCTAAGCCTGGA
AGGCCTGCGGCTTTCGGATCCCATTGTCAATACTCTCGCAAAAAACTCAAATTTAGTGCG
ACTTAACCTTTCTGGGTGTTCTGGATTCTCTGAATTTGCCCTGCAGACTTTGCTAAGCAG
CTGTTCCAGACTGGATGAGCTGAACCTCTCCTGGTGTTTTGATTTCACTGAAAAGCATGT
ACAGGTGGCTGTTGCGCATGTGTCAGAGACCATCACCCAGCTGAATCTTAGCGGCTACAG
AAAGAATCTCCAGAAATCAGATCTCTCTACTTTAGTTAGAAGATGCCCCAATCTTGTCCA
TCTAGACTTAAGTGATAGTGTCATGCTAAAGAATGACTGCTTTCAGGAATTTTTCCAGCT
CAACTACCTCCAACACCTATCACTCAGTCGGTGCTATGATATAATACCTGAAACTTTACT
ATTAGTGACAAGAGCTGGGGTTAGGATCCGGTTGGACTCTGACATCGGATGCCCTCAAAC
ATACAGAACTTCCAAACTCAAGTCCAGCCATAAGCTATTTTGCCAACATGTCAGAGTAAT
CTGTATTTTTGTATGTGATTTCTACTTTTATAGACTTGTTTTAAAACAATAAAACACATT
TTTATAAAAATGAGTGCTTAAAAACAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_032637
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_032637.2, NP_116026.1
RefSeq Size 1462 bp
RefSeq ORF 1233 bp
Locus ID 6502
Cytogenetics 5p13.2
Domains LRR, F-box, LRR_CC
Protein Families Druggable Genome
Protein Pathways Acute myeloid leukemia, Apoptosis, Cell cycle, Oocyte meiosis, p53 signaling pathway, Pathways in cancer, Progesterone-mediated oocyte maturation, Small cell lung cancer, Ubiquitin mediated proteolysis
Gene Summary 'This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class; in addition to an F-box, this protein contains 10 tandem leucine-rich repeats. This protein is an essential element of the cyclin A-CDK2 S-phase kinase. It specifically recognizes phosphorylated cyclin-dependent kinase inhibitor 1B (CDKN1B, also referred to as p27 or KIP1) predominantly in S phase and interacts with S-phase kinase-associated protein 1 (SKP1 or p19). In addition, this gene is established as a protooncogene causally involved in the pathogenesis of lymphomas. Alternative splicing of this gene generates three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2011]'
Transcript Variant: This variant (2) uses an alternate splice junction at the 5' end of a coding exon compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.