FH (NM_000143) Human Untagged Clone
CAT#: SC319415
FH (untagged)-Human fumarate hydratase (FH), nuclear gene encoding mitochondrial protein
"NM_000143" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FH |
Synonyms | FMRD; HLRCC; HsFH; LRCC; MCL; MCUL1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_000143.2
ATTCTACCCAAGCTCCCTCAGCACCATGTACCGAGCACTTCGGCTCCTCGCGCGCTCGCG
TCCCCTCGTGCGGGCTCCAGCCGCAGCCTTAGCTTCGGCTCCCGGCTTGGGTGGCGCGGC CGTGCCCTCGTTTTGGCCTCCGAACGCGGCTCGAATGGCAAGCCAAAATTCCTTCCGGAT AGAATATGATACCTTTGGTGAACTAAAGGTGCCAAATGATAAGTATTATGGCGCCCAGAC CGTGAGATCTACGATGAACTTTAAGATTGGAGGTGTGACAGAACGCATGCCAACCCCAGT TATTAAAGCTTTTGGCATCTTGAAGCGAGCGGCCGCTGAAGTAAACCAGGATTATGGTCT TGATCCAAAGATTGCTAATGCAATAATGAAGGCAGCAGATGAGGTAGCTGAAGGTAAATT AAATGATCATTTTCCTCTCGTGGTATGGCAGACTGGATCAGGAACTCAGACAAATATGAA TGTAAATGAAGTCATTAGCAATAGAGCAATTGAAATGTTAGGAGGTGAACTTGGCAGCAA GATACCTGTGCATCCCAACGATCATGTTAATAAAAGCCAGAGCTCAAATGATACTTTTCC CACAGCAATGCACATTGCTGCTGCAATAGAAGTTCATGAAGTACTGTTACCAGGACTACA GAAGTTACATGATGCTCTTGATGCAAAATCCAAAGAGTTTGCACAGATCATCAAGATTGG ACGTACTCATACTCAGGATGCTGTTCCACTTACTCTTGGGCAGGAATTTAGTGGTTATGT TCAACAAGTAAAATATGCAATGACAAGAATAAAAGCTGCCATGCCAAGAATCTATGAGCT CGCAGCTGGAGGCACTGCTGTTGGTACAGGTTTAAATACTAGAATTGGCTTTGCAGAAAA GGTTGCTGCAAAAGTGGCTGCACTTACAGGCTTGCCTTTTGTCACTGCTCCGAATAAATT TGAAGCTCTGGCTGCTCATGACGCTCTGGTTGAGCTCAGTGGAGCCATGAACACTACTGC CTGCAGTCTGATGAAGATAGCAAATGATATTCGATTTTTGGGTTCTGGTCCTCGGTCAGG TCTGGGAGAATTGATCTTGCCTGAAAATGAACCAGGAAGCAGTATCATGCCAGGCAAGGT GAACCCTACTCAGTGTGAAGCAATGACCATGGTTGCAGCCCAAGTCATGGGGAACCATGT TGCTGTCACTGTCGGAGGCAGCAATGGACATTTTGAGTTGAATGTTTTCAAGCCAATGAT GATTAAAAATGTGTTACACTCAGCCAGGCTGCTGGGGGATGCTTCAGTTTCCTTTACAGA AAACTGCGTGGTGGGAATCCAGGCCAATACAGAAAGGATCAACAAGCTGATGAATGAGTC TCTAATGTTGGTGACAGCTCTCAATCCTCATATAGGGTATGACAAGGCAGCAAAGATTGC TAAGACAGCACACAAAAATGGATCAACCTTAAAGGAAACTGCTATCGAACTTGGCTATCT CACAGCAGAGCAGTTTGACGAATGGGTAAAACCTAAGGACATGCTGGGTCCAAAGTGATT TACATAAATTTATAATGAAAATAAACATGTATAAAATTTAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAACCTCGGG |
Restriction Sites | Please inquire |
ACCN | NM_000143 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000143.2, NP_000134.2 |
RefSeq Size | 1791 bp |
RefSeq ORF | 1533 bp |
Locus ID | 2271 |
Cytogenetics | 1q43 |
Domains | lyase_1 |
Protein Families | Druggable Genome |
Protein Pathways | Citrate cycle (TCA cycle), Metabolic pathways, Pathways in cancer, Renal cell carcinoma |
Gene Summary | 'The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200614 | FH (Myc-DDK-tagged)-Human fumarate hydratase (FH), nuclear gene encoding mitochondrial protein |
USD 98.00 |
|
RG200614 | FH (GFP-tagged) - Human fumarate hydratase (FH), nuclear gene encoding mitochondrial protein |
USD 460.00 |
|
RC200614L1 | Lenti ORF clone of Human fumarate hydratase (FH), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 620.00 |
|
RC200614L2 | Lenti ORF clone of Human fumarate hydratase (FH), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 620.00 |
|
RC200614L3 | Lenti ORF clone of Human fumarate hydratase (FH), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 620.00 |
|
RC200614L4 | Lenti ORF clone of Human fumarate hydratase (FH), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review