Guanylate kinase (GUK1) (NM_000858) Human Untagged Clone

CAT#: SC319492

GUK1 (untagged)-Human guanylate kinase 1 (GUK1), transcript variant 2


  "NM_000858" in other vectors (6)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "GUK1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GUK1
Synonyms GMK
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_000858.4 GAGGTGGCCCCGGATGCTGCGGCGCCCGCTGGCCGGGCTGGCTGCGGCCGCCCTGGGCCG
GGCCCCACCGGACGGCTTGCTCTGCTCTTTACCTGGGGTTGCTGTCGAGGACCCTGTGCA
AGACTCGGCCGGTTTTTCTTTCTCCCTGATGGACAGACCCAAACATAGCCGCGCAGCATC
GTGAAGGGCTGGGGCCTTCACTCCTCTGTGGCTCTGGAAGAGCCCGATTTCCTCAGGAGG
CATGTCGGGCCCCAGGCCTGTGGTGCTGAGCGGGCCTTCGGGAGCTGGGAAGAGCACCCT
GCTGAAGAGGCTGCTCCAGGAGCACAGCGGCATCTTTGGCTTCAGCGTGTCCCATACCAC
GAGGAACCCGAGGCCCGGCGAGGAGAACGGCAAAGATTACTACTTTGTAACCAGGGAGGT
GATGCAGCGTGACATAGCAGCCGGCGACTTCATCGAGCATGCCGAGTTCTCGGGGAACCT
GTATGGCACGAGCAAGGTGGCGGTGCAGGCCGTGCAGGCCATGAACCGCATCTGTGTGCT
GGACGTGGACCTGCAGGGTGTGCGGAACATCAAGGCCACCGATCTGCGGCCCATCTACAT
CTCTGTGCAGCCGCCTTCACTGCACGTGCTGGAGCAGCGGCTGCGGCAGCGCAACACTGA
AACCGAGGAGAGCCTGGTGAAGCGGCTGGCTGCTGCCCAGGCCGACATGGAGAGCAGCAA
GGAGCCCGGCCTGTTTGATGTGGTCATCATTAACGACAGCCTGGACCAGGCCTACGCAGA
GCTGAAGGAGGCGCTCTCTGAGGAAATCAAGAAAGCTCAAAGGACCGGCGCCTGAGGCTT
GCTGTCTGTTCTCGGCACCCCGGGCCCATACAGGACCAGGGCAGCAGCATTGAGCCACCC
CCTTGGCAGGCGATACGGCAGCTCTGTGCCCTTGGCCAGCATGTGGAGTGGAGGAGATGC
TGCCCCTGTGGTTGGAACATCCTGGGGTGACCCCCGACCCAGCCTCGCTGGGCTGTCCCC
TGTCCCTATCTCTCACTCTGGACCCAGGGCTGACATCCTAATAAAATAACTGTTGGATTA
GAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_000858
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000858.4, NP_000849.1
RefSeq Size 1098 bp
RefSeq ORF 594 bp
Locus ID 2987
Cytogenetics 1q42.13
Domains Guanylate_kin, GuKc
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism
Gene Summary 'The protein encoded by this gene is an enzyme that catalyzes the transfer of a phosphate group from ATP to guanosine monophosphate (GMP) to form guanosine diphosphate (GDP). The encoded protein is thought to be a good target for cancer chemotherapy. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]'
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence and contains an alternate coding exon in the 3' end compared to variant 5, that causes a frameshift. The resulting isoform (b) is shorter at the N-terminus and has a shorter and distinct C-terminus compared to isoform c. Variants 2, 3, and 4 all encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.