C1QA (NM_015991) Human Untagged Clone

CAT#: SC319556

C1QA (untagged)-Human complement component 1, q subcomponent, A chain (C1QA)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: C1QA
• Synonyms: complement component 1, q subcomponent, A chain; complement component 1, q subcomponent, alpha polypeptide; complement component C1q, A chain; OTTHUMP00000002936
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_015991.2 CTGGGCGGAGGGCAGGAGCATCCAGTTGGAGTTGACAACAGGAGGCAGAGGCATCATGGA
  GGGTCCCCGGGGATGGCTGGTGCTCTGTGTGCTGGCCATATCGCTGGCCTCTATGGTGAC
  CGAGGACTTGTGCCGAGCACCAGACGGGAAGAAAGGGGAGGCAGGAAGACCTGGCAGACG
  GGGGCGGCCAGGCCTCAAGGGGGAGCAAGGGGAGCCGGGGGCCCCTGGCATCCGGACAGG
  CATCCAAGGCCTTAAAGGAGACCAGGGGGAACCTGGGCCCTCTGGAAACCCCGGCAAGGT
  GGGCTACCCAGGGCCCAGCGGCCCCCTCGGGGCCCGTGGCATCCCGGGAATTAAAGGCAC
  CAAGGGCAGCCCAGGAAACATCAAGGACCAGCCGAGGCCAGCCTTCTCCGCCATTCGGCG
  GAACCCCCCAATGGGGGGCAACGTGGTCATCTTCGACACGGTCATCACCAACCAGGAAGA
  ACCGTACCAGAACCACTCCGGCCGATTCGTCTGCACTGTACCCGGCTACTACTACTTCAC
  CTTCCAGGTGCTGTCCCAGTGGGAAATCTGCCTGTCCATCGTCTCCTCCTCAAGGGGCCA
  GGTCCGACGCTCCCTGGGCTTCTGTGACACCACCAACAAGGGGCTCTTCCAGGTGGTGTC
  AGGGGGCATGGTGCTTCAGCTGCAGCAGGGTGACCAGGTCTGGGTTGAAAAAGACCCCAA
  AAAGGGTCACATTTACCAGGGCTCTGAGGCCGACAGCGTCTTCAGCGGCTTCCTCATCTT
  CCCATCTGCCTGAGCCAGGGAAGGACCCCCTCCCCCACCCACCTCTCTGGCTTCCATGCT
  CCGCCTGTAAAATGGGGGCGCTATTGCTTCAGCTGCTGAAGGGAGGGGGCTGGCTCTGAG
  AGCCCCAGGACTGGCTGCCCCGTGACACATGCTCTAAGAAGCTCGTTTCTTAGACCTCTT
  CCTGGAATAAACATCTGTGTCTGTGTCTGCTGAAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_015991
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_015991.2, NP_057075.1
• RefSeq Size: 1098 bp
• RefSeq ORF: 738 bp
• Locus ID: 712
• Cytogenetics: 1p36.12
• Domains: C1Q, Collagen
• Protein Families: Secreted Protein
• Protein Pathways: Complement and coagulation cascades, Prion diseases, Systemic lupus erythematosus
• Gene Summary: 'This gene encodes the A-chain polypeptide of serum complement subcomponent C1q, which associates with C1r and C1s to yield the first component of the serum complement system. C1q deficiency is associated with lupus erythematosus and glomerulonephritis. C1q is composed of 18 polypeptide chains which include 6 A-chains, 6 B-chains, and 6 C-chains. Each chain contains an N-terminal collagen-like region and a C-terminal C1q globular domain. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]'
  Transcript Variant: This variant (1) uses an alternate splice site in the 5' UTR, compared to variant (2). Variants 1-3 encode the same protein.