Asialoglycoprotein Receptor 1 (ASGR1) (NM_001671) Human Untagged Clone

CAT#: SC319563

ASGR1 (untagged)-Human asialoglycoprotein receptor 1 (ASGR1), transcript variant 1


  "NM_001671" in other vectors (6)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "ASGR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ASGR1
Synonyms ASGPR; ASGPR1; CLEC4H1; HL-1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001671.2 CATCTGCACAGCACTGAAGAACCTGGGAATCAGACCCTGAGACCCTGAGCAATCCCAGGT
CCAGCGCCAGCCCTATCATGACCAAGGAGTATCAAGACCTTCAGCATCTGGACAATGAGG
AGAGTGACCACCATCAGCTCAGAAAAGGGCCACCTCCTCCCCAGCCCCTCCTGCAGCGTC
TCTGCTCCGGACCTCGCCTCCTCCTGCTCTCCCTGGGCCTCAGCCTCCTGCTGCTTGTGG
TTGTCTGTGTGATCGGATCCCAAAACTCCCAGCTGCAGGAGGAGCTGCGGGGCCTGAGAG
AGACGTTCAGCAACTTCACAGCGAGCACGGAGGCCCAGGTCAAGGGCTTGAGCACCCAGG
GAGGCAATGTGGGAAGAAAGATGAAGTCGCTAGAGTCCCAGCTGGAGAAACAGCAGAAGG
ACCTGAGTGAAGATCACTCCAGCCTGCTGCTCCACGTGAAGCAGTTCGTGTCTGACCTGC
GGAGCCTGAGCTGTCAGATGGCGGCGCTCCAGGGCAATGGCTCAGAAAGGACCTGCTGCC
CGGTCAACTGGGTGGAGCACGAGCGCAGCTGCTACTGGTTCTCTCGCTCCGGGAAGGCCT
GGGCTGACGCCGACAACTACTGCCGGCTGGAGGACGCGCACCTGGTGGTGGTCACGTCCT
GGGAGGAGCAGAAATTTGTCCAGCACCACATAGGCCCTGTGAACACCTGGATGGGCCTCC
ACGACCAAAACGGGCCCTGGAAGTGGGTGGACGGGACGGACTACGAGACGGGCTTCAAGA
ACTGGAGGCCGGAGCAGCCGGACGACTGGTACGGCCACGGGCTCGGAGGAGGCGAGGACT
GTGCCCACTTCACCGACGACGGCCGCTGGAACGACGACGTCTGCCAGAGGCCCTACCGCT
GGGTCTGCGAGACAGAGCTGGACAAGGCCAGCCAGGAGCCACCTCTCCTTTAATTTATTT
CTTCAATGCCTCGACCTGCCGCAGGGGTCCGGGATTGGGAATCCGCCCATCTGGGGGCCT
CTTCTGCTTTCTCGGGAATTTTCATCTAGGATTTTAAGGGAAGGGGAAGGATAGGGTGAT
GTTCCGAAGGTGAGGAGCTTGAAACCCGTGGCGCTTTCTGCAGTTTGCAGGTTATCATTG
TGAACTTTTTTTTTTTAAGAGTAAAAAGAAATATACCTAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001671
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001671.2, NP_001662.1
RefSeq Size 1285 bp
RefSeq ORF 876 bp
Locus ID 432
Cytogenetics 17p13.1
Domains CLECT, lectin_N
Protein Families Druggable Genome, Transmembrane
Gene Summary 'This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the more abundant major subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]'
Transcript Variant: This variant (1), also known as H1a, represents the longer transcript and encodes the longer isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.