Cathepsin G (CTSG) (NM_001911) Human Untagged Clone

CAT#: SC319652

CTSG (untagged)-Human cathepsin G (CTSG)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CTSG
• Synonyms: CATG; CG
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001911.2 GCACAGCAGCAACTGACTGGGCAGCCTTTCAGGAAAGATGCAGCCACTCCTGCTTCTGCT
  GGCCTTTCTCCTACCCACTGGGGCTGAGGCAGGGGAGATCATCGGAGGCCGGGAGAGCAG
  GCCCCACTCCCGCCCCTACATGGCGTATCTTCAGATCCAGAGTCCAGCAGGTCAGAGCAG
  ATGTGGAGGGTTCCTGGTGCGAGAAGACTTTGTGCTGACAGCAGCTCATTGCTGGGGAAG
  CAATATAAATGTCACCCTGGGCGCCCACAATATCCAGAGACGGGAAAACACCCAGCAACA
  CATCACTGCGCGCAGAGCCATCCGCCACCCTCAATATAATCAGCGGACCATCCAGAATGA
  CATCATGTTATTGCAGCTGAGCAGAAGAGTCAGACGGAATCGAAACGTGAACCCAGTGGC
  TCTGCCTAGAGCCCAGGAGGGACTGAGACCCGGGACGCTGTGCACTGTGGCCGGCTGGGG
  CAGGGTCAGCATGAGGAGGGGAACAGATACACTCCGAGAGGTGCAGCTGAGAGTGCAGAG
  GGATAGGCAGTGCCTCCGCATCTTCGGTTCCTACGACCCCCGAAGGCAGATTTGTGTGGG
  GGACCGGCGGGAACGGAAGGCTGCCTTCAAGGGGGATTCCGGAGGCCCCCTGCTGTGTAA
  CAATGTGGCCCACGGCATCGTCTCCTATGGAAAGTCGTCAGGGGTTCCTCCAGAAGTCTT
  CACCAGGGTCTCAAGTTTCCTGCCCTGGATAAGGACAACAATGAGAAGCTTCAAACTGCT
  GGATCAGATGGAGACCCCCCTGTGACTGACTCTTCTTCTCGGGGACACAGGCCAGCTCCA
  CAGTGTTGCCAGAGCCTTAATAAACGTCCACAGAGTATAAATAAAAAAAAAAAAAAAAAA
  A
• Restriction Sites: Please inquire
• ACCN: NM_001911
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001911.2, NP_001902.1
• RefSeq Size: 924 bp
• RefSeq ORF: 768 bp
• Locus ID: 1511
• Cytogenetics: 14q12
• Domains: Tryp_SPc
• Protein Families: Druggable Genome, Protease
• Protein Pathways: Lysosome, Neuroactive ligand-receptor interaction, Renin-angiotensin system, Systemic lupus erythematosus
• Gene Summary: 'The protein encoded by this gene, a member of the peptidase S1 protein family, is found in azurophil granules of neutrophilic polymorphonuclear leukocytes. The encoded protease has a specificity similar to that of chymotrypsin C, and may participate in the killing and digestion of engulfed pathogens, and in connective tissue remodeling at sites of inflammation. In addition, the encoded protein is antimicrobial, with bacteriocidal activity against S. aureus and N. gonorrhoeae. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Sep 2014]'