Glutathione S Transferase theta 1 (GSTT1) (NM_000853) Human Untagged Clone

CAT#: SC319671

GSTT1 (untagged)-Human glutathione S-transferase theta 1 (GSTT1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GSTT1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_000853.1 GACTCCCTCTGGTTTCCGGTCAGGTCGGTCGGTCCCCACTATGGGCCTGGAGCTGTACCT
  GGACCTGCTGTCCCAGCCCTGCCGCGCTGTTTACATCTTTGCCAAGAAGAACGACATTCC
  CTTCGAGCTGCGCATCGTGGATCTGATTAAAGGTCAGCACTTAAGCGATGCCTGTGCCCA
  GGTGAACCCCCTCAAGAAGGTGCCAGCCTTGAAGGACGGGGACTTCACCTTGACGGAGAG
  TGTGGCCATCCTGCTCTACCTGACGCGCAAATATAAGGTCCCTGACTACTGGTACCCTCA
  GGACCTGCAGGCCCGTGCCCGTGTGGATGAGTACCTGGCATGGCAGCACACGACTCTGCG
  GAGAAGCTGCCTCCGGGCCTTGTGGCATAAGGTGATGTTCCCTGTTTTCCTGGGTGAGCC
  AGTATCTCCCCAGACACTGGCAGCCACCCTGGCAGAGTTGGATGTGACCCTGCAGTTGCT
  CGAGGACAAGTTCCTCCAGAACAAGGCCTTCCTTACTGGTCCTCACATCTCCTTAGCTGA
  CCTCGTAGCCATCACGGAGCTGATGCATCCCGTGGGTGCTGGCTGCCAAGTCTTCGAAGG
  CCGACCCAAGCTGGCCACATGGCGGCAGCGCGTGGAGGCAGCAGTGGGGGAGGACCTCTT
  CCAGGAGGCCCATGAGGTCATTCTGAAGGCCAAGGACTTCCCACCTGCAGACCCCACCAT
  AAAACAGAAGCTGATGCCCTGGGTGCTGGCCATGATCCGGTGAGCTGGGAAGCCTCACCC
  TTGCACCGTCCTCAGCAGTCCACAAAGCATTTTCATTTCTAATGGCCCATGGGAGCCAGG
  CCCAGAAAGCAGGAATGGCTTGCTTAAGACTTGCCCAAGTCCCAGAGCACCTCACCTCCC
  GAAGCCACCATCCCCACCCTGTCTTCCACAGCCGCCTGAAAGCCACAATGAGAATGATGC
  ACACTGAGGCCTTGTGTCCTTTAATCACTGCATTTCATTTTGATTTTGGATAATAAACCT
  GGGCTCAGCCTGAGCCTCTGCTTCGAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_000853
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000853.1, NP_000844.1
• RefSeq Size: 1004 bp
• RefSeq ORF: 723 bp
• Locus ID: 2952
• Cytogenetics: 22q11.23
• Domains: GST_N, GST_C
• Protein Pathways: Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
• Gene Summary: 'The protein encoded by this gene, glutathione S-transferase (GST) theta 1 (GSTT1), is a member of a superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds. Human GSTs can be divided into five main classes: alpha, mu, pi, theta, and zeta. The theta class includes GSTT1, GSTT2, and GSTT2B. GSTT1 and GSTT2/GSTT2B share 55% amino acid sequence identity and may play a role in human carcinogenesis. The GSTT1 gene is haplotype-specific and is absent from 38% of the population. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2015]'
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).