Biliverdin Reductase (BLVRA) (NM_000712) Human Untagged Clone
CAT#: SC319683
BLVRA (untagged)-Human biliverdin reductase A (BLVRA)
"NM_000712" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BLVRA |
Synonyms | BLVR; BVR; BVRA |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_000712.3
GGTCCGCAAAGCCGGTGGCGCCCGGAGGCTGCACGGAGAGCGGTGCCCGCGTCAGTGACC
GAAGGAAGAGACCAAGATGAATACAGAGCCCGAGAGGAAGTTTGGCGTGGTGGTGGTTGG TGTTGGCCGAGCCGGCTCCGTGCGGATGAGGGACTTGCGGAATCCACACCCTTCCTCAGC GTTCCTGAACCTGATTGGCTTCGTGTCGAGAAGGGAGCTCGGGAGCATTGATGGAGTCCA GCAGATTTCTTTGGAGGATGCTCTTTCCAGCCAAGAGGTGGAGGTCGCCTATATCTGCAG TGAGAGCTCCAGCCATGAGGACTACATCAGGCAGTTCCTTAATGCTGGCAAGCACGTCCT TGTGGAATACCCCATGACACTGTCATTGGCGGCCGCTCAGGAACTGTGGGAGCTGGCTGA GCAGAAAGGAAAAGTCTCGCACGAGGAGCATGTTGAACTCTTGATGGAGGAATTCGCTTT CCTGAAAAAAGAAGTGGTGGGGAAAGACCTGCTGAAAGGGTCGCTCCTCTTCACAGCTGG CCCGTTGGAAGAAGAGCGGTTTGGCTTCCCTGCATTCAGCGGCATCTCTCGCCTGACCTG GCTGGTCTCCCTCTTTGGGGAGCTTTCTCTTGTGTCTGCCACTTTGGAAGAGCGAAAGGA AGATCAGTATATGAAAATGACAGTGTGTCTGGAGACAGAGAAGAAAAGTCCACTGTCATG GATTGAAGAAAAAGGACCTGGTCTAAAACGAAACAGATATTTAAGCTTCCATTTCAAGTC TGGGTCCTTGGAGAATGTGCCAAATGTAGGAGTGAATAAGAACATATTTCTGAAAGATCA AAATATATTTGTCCAGAAACTCTTGGGCCAGTTCTCTGAGAAGGAACTGGCTGCTGAAAA GAAACGCATCCTGCACTGCCTGGGGCTTGCAGAAGAAATCCAGAAATATTGCTGTTCAAG GAAGTAAGAGGAAGAGGTGATGTAGCACTTCCAAGATGGCACCAGCATTTGGTTCTTCTC AAGAGTTGACCATTATCTCTATTCTTAAAATTAAACATGTTGGGGAAACAAATGAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_000712 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000712.3, NP_000703.2 |
RefSeq Size | 1094 bp |
RefSeq ORF | 891 bp |
Locus ID | 644 |
Cytogenetics | 7p13 |
Domains | GFO_IDH_MocA |
Protein Pathways | Porphyrin and chlorophyll metabolism |
Gene Summary | 'The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]' Transcript Variant: This variant (1) represents the predominant transcript. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203243 | BLVRA (Myc-DDK-tagged)-Human biliverdin reductase A (BLVRA) |
USD 420.00 |
|
RG203243 | BLVRA (GFP-tagged) - Human biliverdin reductase A (BLVRA) |
USD 460.00 |
|
RC203243L1 | Lenti ORF clone of Human biliverdin reductase A (BLVRA), Myc-DDK-tagged |
USD 768.00 |
|
RC203243L2 | Lenti ORF clone of Human biliverdin reductase A (BLVRA), mGFP tagged |
USD 620.00 |
|
RC203243L3 | Lenti ORF clone of Human biliverdin reductase A (BLVRA), Myc-DDK-tagged |
USD 620.00 |
|
RC203243L4 | Lenti ORF clone of Human biliverdin reductase A (BLVRA), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review