Relaxin 1 (RLN1) (NM_006911) Human Untagged Clone

CAT#: SC319698

RLN1 (untagged)-Human relaxin 1 (RLN1)


  "NM_006911" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "RLN1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RLN1
Synonyms bA12D24.3.1; bA12D24.3.2; H1; H1RLX; RLXH1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_006911.2 GGTTGAGCCGGGTAGGGAAAGCAGCCTAAAGCCCGGGACAGGCACACAGGCCCAGGTGTG
TAGGCCACAGCAGCCGCAGTCCTGAAAGGCTGCAACACCCAGACCTCCAGGAGAGACCAG
GCCCAGGATGCCTCGCCTGTTCTTGTTCCACCTGCTAGAATTCTGTTTACTACTGAACCA
ATTTTCCAGAGCAGTCGCGGCCAAATGGAAGGACGATGTTATTAAATTATGCGGCCGCGA
ATTAGTTCGCGCGCAGATTGCCATTTGCGGCATGAGCACCTGGAGCAAAAGGTCTCTGAG
CCAGGAAGATGCTCCTCAGACACCTAGACCAGTGGCAGAAATTGTACCATCCTTCATCAA
CAAAGATACAGAAACTATAATTATCATGTTGGAATTCATTGCTAATTTGCCACCGGAGCT
GAAGGCAGCCCTATCTGAGAGGCAACCATCATTACCAGAGCTACAGCAGTATGTACCTGC
ATTAAAGGATTCCAATCTTAGCTTTGAAGAATTTAAGAAACTTATTCGCAATAGGCAAAG
TGAAGCCGCAGACAGCAATCCTTCAGAATTAAAATACTTAGGCTTGGATACTCATTCTCA
AAAAAAGAGACGACCCTACGTGGCACTGTTTGAGAAATGTTGCCTAATTGGTTGTACCAA
AAGGTCTCTTGCTAAATATTGCTGAGATGAAGCTAATTGTGCACATCTTGTCTAATTTTC
ACACATAGTCTTGATGACATTTCACTGATGCTTCTGTCAGGTCCCACTAATTATTAGAAT
ATAAGAAATCTTTATTAATGTTTAGATTTTTCATTTGGTGTGTAAGAAAATATTCTTTGT
ATGATTGTAGTTTCTGTAAATGACACTTTCTATGCTGAAGTCTTTTTGTCTTTTTATTAA
CAGTATAATTGTGTTGATTCTTTTTAATGCTGTTAACTTAAAATTACAATAAAACCTTTG
CCACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_006911
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006911.2, NP_008842.1
RefSeq Size 967 bp
RefSeq ORF 558 bp
Locus ID 6013
Cytogenetics 9p24.1
Domains IlGF
Protein Families Secreted Protein
Gene Summary 'Relaxins are known endocrine and autocrine/paracrine hormones, belonging to the insulin gene superfamily. In humans there are three non-allelic relaxin genes, RLN1, RLN2 and RLN3, where RLN1 and RLN2 share high sequence homology. The protein encoded by this gene is synthesized as a single-chain polypeptide but the active form consists of an A chain and a B chain linked by disulfide bonds. Relaxin is produced by the ovary, and targets the mammalian reproductive system to ripen the cervix, elongate the pubic symphysis and inhibit uterine contraction. It may have additional roles in enhancing sperm motility, regulating blood pressure, controlling heart rate and releasing oxytocin and vasopressin. [provided by RefSeq, Jan 2013]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.