Relaxin 1 (RLN1) (NM_006911) Human Untagged Clone
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | RLN1 |
| Synonyms | bA12D24.3.1; bA12D24.3.2; H1; H1RLX; RLXH1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_006911.2
GGTTGAGCCGGGTAGGGAAAGCAGCCTAAAGCCCGGGACAGGCACACAGGCCCAGGTGTG
TAGGCCACAGCAGCCGCAGTCCTGAAAGGCTGCAACACCCAGACCTCCAGGAGAGACCAG GCCCAGGATGCCTCGCCTGTTCTTGTTCCACCTGCTAGAATTCTGTTTACTACTGAACCA ATTTTCCAGAGCAGTCGCGGCCAAATGGAAGGACGATGTTATTAAATTATGCGGCCGCGA ATTAGTTCGCGCGCAGATTGCCATTTGCGGCATGAGCACCTGGAGCAAAAGGTCTCTGAG CCAGGAAGATGCTCCTCAGACACCTAGACCAGTGGCAGAAATTGTACCATCCTTCATCAA CAAAGATACAGAAACTATAATTATCATGTTGGAATTCATTGCTAATTTGCCACCGGAGCT GAAGGCAGCCCTATCTGAGAGGCAACCATCATTACCAGAGCTACAGCAGTATGTACCTGC ATTAAAGGATTCCAATCTTAGCTTTGAAGAATTTAAGAAACTTATTCGCAATAGGCAAAG TGAAGCCGCAGACAGCAATCCTTCAGAATTAAAATACTTAGGCTTGGATACTCATTCTCA AAAAAAGAGACGACCCTACGTGGCACTGTTTGAGAAATGTTGCCTAATTGGTTGTACCAA AAGGTCTCTTGCTAAATATTGCTGAGATGAAGCTAATTGTGCACATCTTGTCTAATTTTC ACACATAGTCTTGATGACATTTCACTGATGCTTCTGTCAGGTCCCACTAATTATTAGAAT ATAAGAAATCTTTATTAATGTTTAGATTTTTCATTTGGTGTGTAAGAAAATATTCTTTGT ATGATTGTAGTTTCTGTAAATGACACTTTCTATGCTGAAGTCTTTTTGTCTTTTTATTAA CAGTATAATTGTGTTGATTCTTTTTAATGCTGTTAACTTAAAATTACAATAAAACCTTTG CCACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_006911 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_006911.2, NP_008842.1 |
| RefSeq Size | 967 bp |
| RefSeq ORF | 558 bp |
| Locus ID | 6013 |
| Cytogenetics | 9p24.1 |
| Domains | IlGF |
| Protein Families | Secreted Protein |
| Gene Summary | 'Relaxins are known endocrine and autocrine/paracrine hormones, belonging to the insulin gene superfamily. In humans there are three non-allelic relaxin genes, RLN1, RLN2 and RLN3, where RLN1 and RLN2 share high sequence homology. The protein encoded by this gene is synthesized as a single-chain polypeptide but the active form consists of an A chain and a B chain linked by disulfide bonds. Relaxin is produced by the ovary, and targets the mammalian reproductive system to ripen the cervix, elongate the pubic symphysis and inhibit uterine contraction. It may have additional roles in enhancing sperm motility, regulating blood pressure, controlling heart rate and releasing oxytocin and vasopressin. [provided by RefSeq, Jan 2013]' |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203283 | RLN1 (Myc-DDK-tagged)-Human relaxin 1 (RLN1) |
USD 300.00 |
|
| RG203283 | RLN1 (GFP-tagged) - Human relaxin 1 (RLN1) |
USD 460.00 |
|
| RC203283L1 | Lenti ORF clone of Human relaxin 1 (RLN1), Myc-DDK-tagged |
USD 768.00 |
|
| RC203283L2 | Lenti ORF clone of Human relaxin 1 (RLN1), mGFP tagged |
USD 620.00 |
|
| RC203283L3 | Lenti ORF clone of Human relaxin 1 (RLN1), Myc-DDK-tagged |
USD 620.00 |
|
| RC203283L4 | Lenti ORF clone of Human relaxin 1 (RLN1), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China