ACTG2 (NM_001615) Human Untagged Clone
CAT#: SC319705
ACTG2 (untagged)-Human actin, gamma 2, smooth muscle, enteric (ACTG2), transcript variant 1
"NM_001615" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | ACTG2 |
| Synonyms | ACT; ACTA3; ACTE; ACTL3; ACTSG; VSCM |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001615.3
GGGGACACCAGCCCTCAGTCACTGGGAGAAGAACCTCTCATACCCTCGGTGCTCCAGTCC
CCAGCTCACTCAGCCACATACACCATGTGTGAAGAGGAGACCACCGCGCTCGTGTGTGAC AATGGCTCTGGCCTGTGCAAGGCAGGCTTCGCAGGAGATGATGCCCCCCGGGCTGTCTTC CCCTCCATTGTGGGCCGCCCTCGCCACCAGGGTGTGATGGTGGGAATGGGCCAGAAAGAC AGCTATGTGGGGGATGAGGCTCAGAGCAAGCGAGGGATCCTAACTCTCAAATACCCCATT GAACACGGCATCATCACCAACTGGGATGACATGGAGAAGATCTGGCACCACTCCTTCTAC AATGAGCTGCGTGTAGCACCTGAAGAGCACCCCACCCTGCTCACAGAGGCTCCCCTAAAT CCCAAGGCCAACAGGGAGAAGATGACCCAGATCATGTTTGAAACCTTCAATGTCCCTGCC ATGTACGTCGCCATTCAAGCTGTGCTCTCCCTCTATGCCTCTGGCCGCACGACAGGCATC GTCCTGGATTCAGGTGATGGCGTCACCCACAATGTCCCCATCTATGAAGGCTATGCCCTG CCCCATGCCATCATGCGCCTGGACTTGGCTGGCCGTGACCTCACGGACTACCTCATGAAG ATCCTCACAGAGAGAGGCTATTCCTTTGTGACCACAGCTGAGAGAGAAATTGTGCGAGAC ATCAAGGAGAAGCTGTGCTATGTGGCCCTGGATTTTGAGAATGAGATGGCCACAGCAGCT TCCTCTTCCTCCCTGGAGAAGAGCTATGAGCTGCCAGATGGGCAGGTTATCACCATTGGC AATGAGCGCTTCCGCTGCCCTGAGACCCTCTTCCAGCCTTCCTTTATTGGCATGGAGTCC GCTGGAATTCATGAGACAACCTACAATTCCATCATGAAGTGTGACATTGACATCCGTAAG GACTTATATGCCAACAATGTCCTCTCTGGGGGCACCACCATGTACCCTGGCATTGCTGAC AGGATGCAGAAGGAGATCACAGCCCTGGCCCCCAGCACCATGAAGATCAAGATTATTGCT CCCCCAGAGCGGAAGTACTCAGTCTGGATCGGGGGCTCTATCCTGGCCTCTCTCTCCACC TTCCAGCAGATGTGGATCAGCAAGCCTGAGTATGATGAGGCAGGGCCCTCCATTGTCCAC AGGAAGTGCTTCTAAAGTCAGAACAGGTTCTCCAAGGATCCCCTCGAGACTACTCTGTTA CCAGTCATGAAACATTAAAACCTACAAGCCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAA AA |
| Restriction Sites | Please inquire |
| ACCN | NM_001615 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001615.3, NP_001606.1 |
| RefSeq Size | 1345 bp |
| RefSeq ORF | 1131 bp |
| Locus ID | 72 |
| Cytogenetics | 2p13.1 |
| Domains | ACTIN |
| Protein Pathways | Vascular smooth muscle contraction |
| Gene Summary | 'Actins are highly conserved proteins that are involved in various types of cell motility and in the maintenance of the cytoskeleton. Three types of actins, alpha, beta and gamma, have been identified in vertebrates. Alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton and as mediators of internal cell motility. This gene encodes actin gamma 2; a smooth muscle actin found in enteric tissues. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Based on similarity to peptide cleavage of related actins, the mature protein of this gene is formed by removal of two N-terminal peptides.[provided by RefSeq, Dec 2010]' Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203151 | ACTG2 (Myc-DDK-tagged)-Human actin, gamma 2, smooth muscle, enteric (ACTG2), transcript variant 1 |
USD 457.00 |
|
| RG203151 | ACTG2 (GFP-tagged) - Human actin, gamma 2, smooth muscle, enteric (ACTG2), transcript variant 1 |
USD 460.00 |
|
| RC203151L1 | Lenti ORF clone of Human actin, gamma 2, smooth muscle, enteric (ACTG2), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
| RC203151L2 | Lenti ORF clone of Human actin, gamma 2, smooth muscle, enteric (ACTG2), transcript variant 1, mGFP tagged |
USD 620.00 |
|
| RC203151L3 | Lenti ORF clone of Human actin, gamma 2, smooth muscle, enteric (ACTG2), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
| RC203151L4 | Lenti ORF clone of Human actin, gamma 2, smooth muscle, enteric (ACTG2), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China