Lactate Dehydrogenase B (LDHB) (NM_002300) Human Untagged Clone
CAT#: SC319772
LDHB (untagged)-Human lactate dehydrogenase B (LDHB), transcript variant 1
"NM_002300" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | LDHB |
| Synonyms | HEL-S-281; LDH-B; LDH-H; LDHBD; TRG-5 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_002300.3
GGGGCTTGCAGAGCCGGCGCCGGAGGAGACGCACGCAGCTGACTTTGTCTTCTCCGCACG
ACTGTTACAGAGGTCTCCAGAGCCTTCTCTCTCCTGTGCAAAATGGCAACTCTTAAGGAA AAACTCATTGCACCAGTTGCGGAAGAAGAGGCAACAGTTCCAAACAATAAGATCACTGTA GTGGGTGTTGGACAAGTTGGTATGGCGTGTGCTATCAGCATTCTGGGAAAGTCTCTGGCT GATGAACTTGCTCTTGTGGATGTTTTGGAAGATAAGCTTAAAGGAGAAATGATGGATCTG CAGCATGGGAGCTTATTTCTTCAGACACCTAAAATTGTGGCAGATAAAGATTATTCTGTG ACCGCCAATTCTAAGATTGTAGTGGTAACTGCAGGAGTCCGTCAGCAAGAAGGGGAGAGT CGGCTCAATCTGGTGCAGAGAAATGTTAATGTCTTCAAATTCATTATTCCTCAGATCGTC AAGTACAGTCCTGATTGCATCATAATTGTGGTTTCCAACCCAGTGGACATTCTTACGTAT GTTACCTGGAAACTAAGTGGATTACCCAAACACCGCGTGATTGGAAGTGGATGTAATCTG GATTCTGCTAGATTTCGCTACCTTATGGCTGAAAAACTTGGCATTCATCCCAGCAGCTGC CATGGATGGATTTTGGGGGAACATGGCGACTCAAGTGTGGCTGTGTGGAGTGGTGTGAAT GTGGCAGGTGTTTCTCTCCAGGAATTGAATCCAGAAATGGGAACTGACAATGATAGTGAA AATTGGAAGGAAGTGCATAAGATGGTGGTTGAAAGTGCCTATGAAGTCATCAAGCTAAAA GGATATACCAACTGGGCTATTGGATTAAGTGTGGCTGATCTTATTGAATCCATGTTGAAA AATCTATCCAGGATTCATCCCGTGTCAACAATGGTAAAGGGGATGTATGGCATTGAGAAT GAAGTCTTCCTGAGCCTTCCATGTATCCTCAATGCCCGGGGATTAACCAGCGTTATCAAC CAGAAGCTAAAGGATGATGAGGTTGCTCAGCTCAAGAAAAGTGCAGATACCCTGTGGGAC ATCCAGAAGGACCTAAAAGACCTGTGACTAGTGAGCTCTAGGCTGTAGAAATTTAAAAAC TACAATGTGATTAACTCGAGCCTTTAGTTTTCATCCATGTACATGGATCACAGTTTGCTT TGATCTTCTTCAATATGTGAATTTGGGCTCACAGAATCAAAGCCTATGCTTGGTTTAATG CTTGCAATCTGAGCTCTTGAACAAATAAAATTAACTATTGTAGTGCGAAAAAAAAAAAAA AAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_002300 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_002300.3, NP_002291.1 |
| RefSeq Size | 1336 bp |
| RefSeq ORF | 1005 bp |
| Locus ID | 3945 |
| Cytogenetics | 12p12.1 |
| Domains | ldh |
| Protein Families | Druggable Genome |
| Protein Pathways | Cysteine and methionine metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Propanoate metabolism, Pyruvate metabolism |
| Gene Summary | 'This gene encodes the B subunit of lactate dehydrogenase enzyme, which catalyzes the interconversion of pyruvate and lactate with concomitant interconversion of NADH and NAD+ in a post-glycolysis process. Alternatively spliced transcript variants have been found for this gene. Recent studies have shown that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Mutations in this gene are associated with lactate dehydrogenase B deficiency. Pseudogenes have been identified on chromosomes X, 5 and 13. [provided by RefSeq, Feb 2016]' Transcript Variant: This variant (1) encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (LDHB) results from translation termination at the upstream UGA stop codon, while the longer isoform (LDHBx) results from UGA stop codon readthrough to the downstream UAG termination codon. This RefSeq represents the shorter isoform (LDHB), which is localized in the cytosol. Variants 1 and 2 encode the same isoform. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC205074 | LDHB (Myc-DDK-tagged)-Human lactate dehydrogenase B (LDHB), transcript variant 1 |
USD 686.00 |
|
| RG205074 | LDHB (GFP-tagged) - Human lactate dehydrogenase B (LDHB), transcript variant 1 |
USD 460.00 |
|
| RC205074L1 | Lenti ORF clone of Human lactate dehydrogenase B (LDHB), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
| RC205074L2 | Lenti ORF clone of Human lactate dehydrogenase B (LDHB), transcript variant 1, mGFP tagged |
USD 620.00 |
|
| RC205074L3 | Lenti ORF clone of Human lactate dehydrogenase B (LDHB), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
| RC205074L4 | Lenti ORF clone of Human lactate dehydrogenase B (LDHB), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China