Cystatin SA (CST2) (NM_001322) Human Untagged Clone
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CST2 |
| Synonyms | MGC71924 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001322.2
GGGGGATCCCTGCCTCAGGCTCTCAACCTCCTCTCCTGCAGCTCCAGCTCTGTGCTCTGC
CTGCGAGGAGACCATGGCCTGGCCCCTGTGCACCCTGCTGCTCCTGCTGGCCACCCAGGC TGTGGCCCTGGCCTGGAGCCCCCAGGAGGAGGACAGGATAATCGAGGGTGGCATCTATGA TGCAGACCTCAATGATGAGCGGGTACAGCGTGCCCTTCACTTTGTCATCAGCGAGTATAA CAAGGCCACTGAAGATGAGTACTACAGACGCCTGCTGCGGGTGCTACGAGCCAGGGAGCA GATCGTGGGCGGGGTGAATTACTTCTTCGACATAGAGGTGGGCCGAACCATATGTACCAA GTCCCAGCCCAACTTGGACACCTGTGCCTTCCATGAACAGCCAGAACTGCAGAAGAAACA GTTGTGCTCTTTCCAGATCTACGAAGTTCCCTGGGAGGACAGAATGTCCCTGGTGAATTC CAGGTGTCAAGAAGCCTAGGGATCTGTGCCAGGGAGTCACACTGACCACCTCCTACTCCC ACCCCTTGTAGTGCTCCCACCCCTGGACTGGTGGCCCCCACCCTGTGGGAGGTCTCCCCA TGCACCTGCAGCAGGAGAAGACAGAGAAGGCTGCAGGAGGCCTTTGTTGCTCAGCAGGGG ACTCTGCCCTCCCTCCTTCCTTTTGCTTCTCATAGCCCTGGTACATGGTACACACACCCC CACCTCCTGCAATTAAACAGTAGCATCATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001322 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001322.2, NP_001313.1 |
| RefSeq Size | 694 bp |
| RefSeq ORF | 426 bp |
| Locus ID | 1470 |
| Cytogenetics | 20p11.21 |
| Domains | CY |
| Protein Families | Secreted Protein |
| Gene Summary | 'The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a secreted thiol protease inhibitor found at high levels in saliva, tears and seminal plasma. [provided by RefSeq, Jul 2008]' |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209350 | CST2 (Myc-DDK-tagged)-Human cystatin SA (CST2) |
USD 150.00 |
|
| RG209350 | CST2 (GFP-tagged) - Human cystatin SA (CST2) |
USD 460.00 |
|
| RC209350L3 | Lenti ORF clone of Human cystatin SA (CST2), Myc-DDK-tagged |
USD 620.00 |
|
| RC209350L4 | Lenti ORF clone of Human cystatin SA (CST2), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China