FCN1 (NM_002003) Human Untagged Clone
CAT#: SC319934
FCN1 (untagged)-Human ficolin (collagen/fibrinogen domain containing) 1 (FCN1)
"NM_002003" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FCN1 |
Synonyms | FCNM |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002003.2
AGAGTCAAAGGCCAGAGAGCATGGAGCTGAGTGGAGCCACCATGGCCCGGGGTCTCGCTG
TCCTGCTAGTCTTGTTCCTGCATATCAAGAACCTGCCTGCCCAGGCTGCGGACACATGTC CAGAGGTGAAGGTGGTGGGCCTGGAGGGCTCTGACAAGCTCACCATTCTCCGAGGCTGCC CGGGGCTGCCCGGGGCCCCAGGGCCAAAGGGAGAGGCAGGTGTCATTGGAGAGAGAGGAG AACGCGGTCTCCCTGGAGCCCCTGGAAAGGCAGGACCAGTGGGGCCCAAAGGAGACCGAG GAGAGAAGGGGATGCGTGGAGAGAAAGGAGACGCTGGGCAGTCTCAGTCGTGTGCGACAG GCCCACGCAACTGCAAGGACCTGCTAGACCGGGGGTATTTCCTGAGCGGCTGGCACACCA TCTACCTGCCCGACTGCCGGCCCCTGACTGTGCTCTGTGACATGGACACGGACGGAGGGG GCTGGACCGTTTTCCAGCGGAGGATGGATGGCTCTGTGGACTTCTATCGGGACTGGGCCG CATACAAGCAGGGCTTCGGCAGTCAGCTGGGGGAGTTCTGGCTGGGGAACGACAACATCC ACGCCCTGACTGCCCAGGGAAGCAGCGAGCTCCGTGTAGACCTGGTGGACTTTGAGGGCA ACCACCAGTTTGCTAAGTACAAATCATTCAAGGTGGCTGACGAGGCAGAGAAGTACAAGC TGGTACTGGGAGCCTTTGTCGGGGGCAGTGCGGGTAATTCTCTAACGGGCCACAACAACA ACTTCTTCTCCACCAAAGACCAAGACAATGATGTGAGTTCTTCGAATTGTGCTGAGAAGT TCCAGGGAGCCTGGTGGTACGCCGACTGTCATGCTTCAAACCTCAATGGTCTCTACCTCA TGGGACCCCATGAGAGCTATGCCAATGGTATCAACTGGAGTGCGGCGAAGGGGTACAAAT ATAGCTACAAGGTGTCAGAGATGAAGGTGCGGCCCGCCTAGACGGGCCAGGACCCCTCCA CATGCACCTGCTAGTGGGGAGGCCACACCCACAAGCGCTGCGTCGTGGAAGTCACCCCAT TTCCCCAGCCAGACACACTCCCATGACGCCCACAGCTGCCCCTTTGCCCCCAGCTCAGTC AAGCCGCCACATGCCCACAACCTCACCAGAGGGAGAATTATGTTTCTAAATATGTTTACT TTGGGACAGAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002003 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002003.2, NP_001994.2 |
RefSeq Size | 1292 bp |
RefSeq ORF | 981 bp |
Locus ID | 2219 |
Cytogenetics | 9q34.3 |
Domains | FBG, Collagen |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | ' The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204637 | FCN1 (Myc-DDK-tagged)-Human ficolin (collagen/fibrinogen domain containing) 1 (FCN1) |
USD 420.00 |
|
RG204637 | FCN1 (GFP-tagged) - Human ficolin (collagen/fibrinogen domain containing) 1 (FCN1) |
USD 460.00 |
|
RC204637L1 | Lenti ORF clone of Human ficolin (collagen/fibrinogen domain containing) 1 (FCN1), Myc-DDK-tagged |
USD 620.00 |
|
RC204637L2 | Lenti ORF clone of Human ficolin (collagen/fibrinogen domain containing) 1 (FCN1), mGFP tagged |
USD 620.00 |
|
RC204637L3 | Lenti ORF clone of Human ficolin (collagen/fibrinogen domain containing) 1 (FCN1), Myc-DDK-tagged |
USD 620.00 |
|
RC204637L4 | Lenti ORF clone of Human ficolin (collagen/fibrinogen domain containing) 1 (FCN1), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review