FKBP1B (NM_054033) Human Untagged Clone

CAT#: SC320205

FKBP1B (untagged)-Human FK506 binding protein 1B, 12.6 kDa (FKBP1B), transcript variant 2


  "NM_054033" in other vectors (4)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "FKBP1B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FKBP1B
Synonyms FKBP1L; FKBP12.6; OTK4; PKBP1L; PPIase
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_054033.1 GCGAGCCGGAGCGACGGCGGGGCTGGGGCCGGAGCCGAGCCGGGGTCGGGCAGCAGCAGG
GACCCCCCAGAGGCGGGGCCTGTGGGACCGCTATGGGCGTGGAGATCGAGACCATCTCCC
CCGGAGACGGAAGGACATTCCCCAAGAAGGGCCAAACGTGTGTGGTGCACTACACAGGAA
TGCTCCAAAATGGGAAGAAGTTTGATTCATCCAGAGACAGAAACAAACCTTTCAAGTTCA
GAATTGGCAAACAGGAAGTCATCAAAGGTTTTGAAGAGGGTGCAGCCCAGCTGGGTCCTC
TTTCTCCTCTCCCCATCTGCCCCCATCCCTGCTAGATGAGCTTGGGGCAGAGGGCGAAGC
TGACCTGCACCCCTGATGTGGCATATGGAGCCACGGGCCACCCCGGTGTCATCCCTCCCA
ATGCCACCCTCATCTTTGACGTGGAGCTGCTCAACTTAGAGTGAAGGCAGGAAGGAACTC
AAGGTGGCTGGAGATGGCTGCTGCTCACCCTCCTAGCCTGCTCTGCCACTGGGACGGCTC
CTGCTTTTGGGGCTCTTGATCAGTGTGCTAACCTCACTGCCTCATGGCATCATCCATTCT
CTCTGCCCAAGTTGCTCTGTATGTGTTCGTCAGTGTTCATGCGAATTCTTGCTTGAGGAA
ACTTCGGTTGCAGATTGAAGCATTTCAGGTTGTGCATTTTGTGTGATGCATGTAGTAGCC
TTTCCTGATGACAGAACACAGATCTCTTGTTCGCACAATCTACACTGCCTTACCTTCACT
TAAACCACACACACAAGGTGCTCAGACATGAAATGTACATGGCGTACCGTACACAGAGGG
ACTTGAGCCAGTTACCTTTGCTGTCACTTTCTCTCTTATAAATTCTGTTAGCTGCTCACT
TAAACAATGTCCTCTTTGAGAAAATGTAAAATAAAGGCTCTGTGCTTGACAAAAAAAAAA
AAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_054033
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_054033.1, NP_473374.1
RefSeq Size 972 bp
RefSeq ORF 243 bp
Locus ID 2281
Cytogenetics 2p23.3
Domains FKBP
Protein Families Druggable Genome
Gene Summary 'The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is highly similar to the FK506-binding protein 1A. Its physiological role is thought to be in excitation-contraction coupling in cardiac muscle. There are two alternatively spliced transcript variants of this gene encoding different isoforms. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.