IKB alpha (NFKBIA) (NM_020529) Human Untagged Clone

CAT#: SC320207

NFKBIA (untagged)-Human nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (NFKBIA)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NFKBIA
• Synonyms: EDAID2; IKBA; MAD-3; NFKBI
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_020529, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTCCAGGCGGCCGAGCGCCCCCAGGAGTGGGCCATGGAGGGCCCCCGCGACGGGCTGAAGAAGGAGC
  GGCTACTGGACGACCGCCACGACAGCGGCCTGGACTCCATGAAAGACGAGGAGTACGAGCAGATGGTCAA
  GGAGCTGCAGGAGATCCGCCTCGAGCCGCAGGAGGTGCCGCGCGGCTCGGAGCCCTGGAAGCAGCAGCTC
  ACCGAGGACGGGGACTCGTTCCTGCACTTGGCCATCATCCATGAAGAAAAGGCACTGACCATGGAAGTGA
  TCCGCCAGGTGAAGGGAGACCTGGCCTTCCTCAACTTCCAGAACAACCTGCAGCAGACTCCACTCCACTT
  GGCTGTGATCACCAACCAGCCAGAAATTGCTGAGGCACTTCTGGGAGCTGGCTGTGATCCTGAGCTCCGA
  GACTTTCGAGGAAATACCCCCCTACACCTTGCCTGTGAGCAGGGCTGCCTGGCCAGCGTGGGAGTCCTGA
  CTCAGTCCTGCACCACCCCGCACCTCCACTCCATCCTGAAGGCTACCAACTACAATGGCCACACGTGTCT
  ACACTTAGCCTCTATCCATGGCTACCTGGGCATCGTGGAGCTTTTGGTGTCCTTGGGTGCTGATGTCAAT
  GCTCAGGAGCCCTGTAATGGCCGGACTGCCCTTCACCTCGCAGTGGACCTGCAAAATCCTGACCTGGTGT
  CACTCCTGTTGAAGTGTGGGGCTGATGTCAACAGAGTTACCTACCAGGGCTATTCTCCCTACCAGCTCAC
  CTGGGGCCGCCCAAGCACCCGGATACAGCAGCAGCTGGGCCAGCTGACACTAGAAAACCTTCAGATGCTG
  CCAGAGAGTGAGGATGAGGAGAGCTATGACACAGAGTCAGAGTTCACGGAGTTCACAGAGGACGAGCTGC
  CCTATGATGACTGTGTGTTTGGAGGCCAGCGTCTGACGTTATGA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_020529
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_020529.1, NP_065390.1
• RefSeq Size: 1550 bp
• RefSeq ORF: 954 bp
• Locus ID: 4792
• Cytogenetics: 14q13.2
• Domains: ANK
• Protein Families: Druggable Genome
• Protein Pathways: Adipocytokine signaling pathway, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Cytosolic DNA-sensing pathway, Epithelial cell signaling in Helicobacter pylori infection, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, Pathways in cancer, Prostate cancer, RIG-I-like receptor signaling pathway, Small cell lung cancer, T cell receptor signaling pathway, Toll-like receptor signaling pathway
• Gene Summary: 'This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease. [provided by RefSeq, Aug 2011]'