PITX1 (NM_002653) Human Untagged Clone
CAT#: SC320324
PITX1 (untagged)-Human paired-like homeodomain 1 (PITX1)
"NM_002653" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PITX1 |
Synonyms | BFT; CCF; LBNBG; POTX; PTX1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002653 edited
CTGGGGACTTCGAGGCGGCCGAGACGGGAGTTGATTCTAGGCGAAACAAGTCATTTGAGG CCTGAGGTCGCAGCCAGGGCGGCGGGGCGCGCCCAGCCCCGGCCCCTGGAGCGCCCGCCG CGGTCCCCACCTCCATGGACGCCTTCAAGGGGGGCATGAGCCTGGAGCGGCTGCCGGAGG GGCTCCGGCCGCCGCCGCCGCCACCCCATGACATGGGGCCCGCCTTCCACCTGGCCCGGC CCGCCGACCCCCGCGAGCCGCTCGAGAACTCCGCCAGCGAGTCGTCTGACACGGAGCTGC CAGAGAAGGAGCGCGGCGGGGAACCCAAGGGGCCCGAGGACAGTGGTGCGGGAGGCACGG GCTGCGGCGGCGCAGACGACCCAGCCAAGAAGAAGAAGCAGCGGCGGCAACGTACGCACT TCACAAGCCAGCAGTTGCAAGAGCTAGAGGCCACGTTCCAGAGGAACCGCTACCCCGACA TGAGCATGAGGGAGGAGATCGCCGTGTGGACCAACCTCACCGAGCCGCGCGTGCGGGTCT GGTTCAAGAACCGGCGAGCCAAGTGGCGTAAGCGCGAGCGTAACCAGCAGCTGGACCTGT GCAAGGGTGGCTACGTGCCGCAGTTCAGCGGCCTAGTGCAGCCCTACGAGGACGTGTACG CCGCCGGCTACTCCTACAACAACTGGGCCGCCAAGAGCCTGGCGCCAGCGCCGCTCTCCA CCAAGAGCTTCACCTTCTTCAACTCCATGAGCCCGCTGTCGTCGCAGTCCATGTTCTCAG CACCCAGCTCCATCTCCTCCATGACCATGCCGTCCAGCATGGGCCCAGGCGCCGTGCCTG GCATGCCCAACTCGGGCCTCAACAACATCAACAACCTCACCGGCTCCTCGCTCAACTCGG CCATGTCGCCGGGCGCTTGCCCGTACGGCACTCCCGCCTCGCCCTACAGCGTCTACCGGG ACACGTGCAACTCGAGCCTAGCCAGCCTGCGGCTCAAGTCCAAACAGCACTCGTCGTTTG GCTACGGCGCCCTGCAGGGCCCGGCCTCGGGCCTCAACGCGTGCCAGTACAACAGCTGAC CGCCCCGCCGCACCACGCGGGCCGGCGGCCGGAGCGGGGAAGGGCGCGGGCGCGGAGGAC GCACGCGGGGCCCCGGCTCGCAAGCCCCAGCTCACCGCGCCGCGGACCTCACACCTGCGC AGCCCCCTCCTCCCACTTCCCACTCCGGGTTGGTTTTGTGTTTGCTTTTCCGGACCCCAC TCTGCCCTCCAAAAAGACAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002653 |
Insert Size | 1500 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_002653.3 |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002653.3, NP_002644.3 |
RefSeq Size | 2373 bp |
RefSeq ORF | 945 bp |
Locus ID | 5307 |
Cytogenetics | 5q31.1 |
Protein Families | Transcription Factors |
Gene Summary | 'This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. Members of this family are involved in organ development and left-right asymmetry. This protein acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC303233 | PITX1 (untagged)-Human paired-like homeodomain 1 (PITX1) |
USD 660.00 |
|
RC202570 | PITX1 (Myc-DDK-tagged)-Human paired-like homeodomain 1 (PITX1) |
USD 420.00 |
|
RG202570 | PITX1 (GFP-tagged) - Human paired-like homeodomain 1 (PITX1) |
USD 460.00 |
|
RC202570L1 | Lenti-ORF clone of PITX1 (Myc-DDK-tagged)-Human paired-like homeodomain 1 (PITX1) |
USD 768.00 |
|
RC202570L2 | Lenti-ORF clone of PITX1 (mGFP-tagged)-Human paired-like homeodomain 1 (PITX1) |
USD 620.00 |
|
RC202570L3 | Lenti-ORF clone of PITX1 (Myc-DDK-tagged)-Human paired-like homeodomain 1 (PITX1) |
USD 620.00 |
|
RC202570L4 | Lenti-ORF clone of PITX1 (mGFP-tagged)-Human paired-like homeodomain 1 (PITX1) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review