Peptide YY (PYY) (NM_004160) Human Untagged Clone

CAT#: SC320515

PYY (untagged)-Human peptide YY (PYY)


  "NM_004160" in other vectors (5)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PYY
Synonyms PYY-I; PYY1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_004160.3 GCCCCTGGAGGAACTGAACCCACTATCGGTCATGGGGCCGAGACTAAATGTGGCGGGTTG
TCTTTAATCTGCTGCCAAGAGGAAACTCATTCAGGCAAGTTCAGCCCTTTATGAGGAATT
CCCCTGTGGTCACATTCCAATTCCTGGACCTGCTGCCACCCTCAGAACTGCATGCTCCTT
CTTCAGACTTTCTAAGAATGACTCAGGTCATTGGTGGAGTGAAGTCAAGATTTCCAACTC
AGTCACCTGAAGAGATGGAGATACCATTCATGGAGCTGGAGGTCCCTGGAGATTTGGGAA
TTCAGATAACAAGCTAAGATAAGGAGTTTGCCTACCTCTGTCCTAGAGCGAAGCCTGAGC
CTTGGGCGCGCAGCACACCACAAGTATCTGTTACTGTGTTTTGCAGAAGCTTCAGGCGGG
GATATAAACCCCACAAGGAAAGCGCTGAGCAGAGGAGGCCTCAGCTTGACCTGCGGCAGT
GCAGCCCTTGGGACTTCCCTCGCCTTCCACCTCCTGCTCGTCTGCTTCACAAGCTATCGC
TATGGTGTTCGTGCGCAGGCCGTGGCCCGCCTTGACCACAGTGCTTCTGGCCCTGCTCGT
CTGCCTAGGGGCGCTGGTCGACGCCTACCCCATCAAACCCGAGGCTCCCGGCGAAGACGC
CTCGCCGGAGGAGCTGAACCGCTACTACGCCTCCCTGCGCCACTACCTCAACCTGGTCAC
CCGGCAGCGGTATGGGAAAAGAGACGGCCCGGACAGGCTTCTTTCCAAAACGTTCTTCCC
CGACGGCGAGGACCGCCCCGTCAGGTCGCGGTCGGAGGGCCCAGACCTGTGGTGAGGACC
CCTGAGGCCTCCTGGGAGATCTGCCAACCACGCCCACGTCATTTGCATACGCACTCCCGA
CCCCAGAAACCCGGATTCTGCCTCCCGACGGCGGCGTCTGGGCAGGGTTCGGGTGCGGCC
CTCCGCCCGCGTCTCGGTGCCCCCGCCCCCTGGGCTGGAGGGCTGTGTGTGGTCCTTCCC
TGGTCCCAAAATAAAGAGCAAATTCCACAGAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_004160
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004160.3, NP_004151.2
RefSeq Size 1069 bp
RefSeq ORF 294 bp
Locus ID 5697
Cytogenetics 17q21.31
Protein Families Secreted Protein, Transmembrane
Gene Summary 'This gene encodes a member of the neuropeptide Y (NPY) family of peptides. The encoded preproprotein is proteolytically processed to generate two alternative peptide products that differ in length by three amino acids. These peptides, secreted by endocrine cells in the gut, exhibit different binding affinities for each of the neuropeptide Y receptors. Binding of the encoded peptides to these receptors mediates regulation of pancreatic secretion, gut mobility and energy homeostasis. Rare variations in this gene could increase susceptibility to obesity and elevated serum levels of the encoded peptides may be associated with anorexia nervosa. [provided by RefSeq, Feb 2016]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.