CFAP410 (NM_004928) Human Untagged Clone
CAT#: SC320520
C21orf2 (untagged)-Human chromosome 21 open reading frame 2 (C21orf2)
"NM_004928" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CFAP410 |
Synonyms | C21orf2; LRRC76; RDMS; SMDAX; YF5/A2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_004928.1
GCGGCGCCCAAGCGGCCCCAGCGGGCTCGCGTCGCCCCGCTCTCCTCACCGAGCCGCCAA
TCGGCTCAGGATCCGCCCCTGACGACGCGGGCCCCGCCCCTGGAGACACGCGCCGCGCAG TCGTCACCCGCCCGGGATCAGGAGGCCGGGGGCGCCCGCCGGTCGGGCCTGGGCGGCCGC CATGAAGCTGACGCGGAAGATGGTTCTGACCCGGGCCAAGGCCTCGGAGCTGCACAGCGT GCGCAAGCTCAACTGCTGGGGCAGCCGCCTCACAGATATCTCCATTTGCCAGGAGATGCC CAGCCTGGAGGTGATCACGCTCAGTGTCAACAGCATCTCCACCCTGGAGCCTGTGAGCCG GTGCCAGCGCCTGAGTGAGCTGTACCTGCGGAGGAACCGCATCCCCAGCCTGGCTGAGCT CTTCTACCTGAAGGGGCTGCCGCGTCTGCGGGTGCTGTGGCTGGCCGAGAACCCGTGCTG CGGCACCAGCCCCCACCGCTACCGCATGACCGTGCTGCGCACCCTGCCGCGCCTACAGAA GCTGGACAACCAGGCTGTGACGGAGGAGGAGCTGTCCCGTGCACTGAGTGAGGGAGAGGA GATCACTGCGGCCCCAGAGAGAGAGGGCACAGGCCACGGCGGCCCCAAGCTATGCTGCAC ACTGAGCTCCCTCAGCTCCGCTGCTGAGACTGGCCGGGACCCGCTGGACAGCGAGGAGGA GGCAACCAGCGGCGCCCAGGATGAACGTGGCCTGAAGCCGCCTTCCCGGGGCCAGTTTCC TTCCCTCTCAGCCAGGGATGCCTCGAGCAGCCACAGGGGCAGGAACGTCCTGACTGCCAT CCTGCTGCTGCTGCGGGAGCTGGATGCAGAGGGGCTGGAGGCCGTGCAGCAGACTGTGGG CAGCCGGCTGCAGGCCCTGCGTGGGGAAGAGGTGCAGGAGCACGCCGAGTGACCGCAGGA CCTGAACGCCGCTCCAGCCTCCACGGGGACCCCAGCGTCTTCCCCAGCCCCCGGGAGCTG GAGGGTGGCTGCCATGGCCGCAGCCCCGGCCCCACACAAAAGCCTCCCCGGTTTGCCACA TCGGCCGAGGGCAGGAGTGGGTGTTAGGTACTGGCTAACCGGGGCGGTGGAGATGCCTGT CTACACCAGTCCTGTCCCCAGGACTCCCCTTCTGTGGTCTGGAGGTTCTAGGCTGGCCTG GGCTCTTAAAGGGAGGATTTTGCAGGCTGTCCTCCCTAATAAAAGATTTTCCCAAGGTTG AAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004928 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004928.1, NP_004919.1 |
RefSeq Size | 2114 bp |
RefSeq ORF | 771 bp |
Locus ID | 755 |
Cytogenetics | 21q22.3 |
Domains | LRR, LRRcap |
Gene Summary | 'Four alternatively spliced transcript variants encoding four different isoforms have been found for this nuclear gene. All isoforms contain leucine-rich repeats. Three of these isoforms are mitochondrial proteins and one of them lacks the target peptide, so is not located in mitochondrion. This gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. [provided by RefSeq, Sep 2012]' Transcript Variant: This variant (1) encodes a mitochondrial protein (isoform 1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC117034 | C21orf2 (untagged)-Human chromosome 21 open reading frame 2 (C21orf2) |
USD 310.00 |
|
RC210047 | C21orf2 (Myc-DDK-tagged)-Human chromosome 21 open reading frame 2 (C21orf2) |
USD 420.00 |
|
RG210047 | C21orf2 (GFP-tagged) - Human chromosome 21 open reading frame 2 (C21orf2) |
USD 460.00 |
|
RC210047L3 | Lenti-ORF clone of C21orf2 (Myc-DDK-tagged)-Human chromosome 21 open reading frame 2 (C21orf2) |
USD 620.00 |
|
RC210047L4 | Lenti-ORF clone of C21orf2 (mGFP-tagged)-Human chromosome 21 open reading frame 2 (C21orf2) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review