RPL17 (NM_000985) Human Untagged Clone

CAT#: SC320579

RPL17 (untagged)-Human ribosomal protein L17 (RPL17), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RPL17
• Synonyms: L17; PD-1; RPL23
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_000985.3 AGCAGCCTGAGGGTTGCCTGGATTGGTGAGGCCCGTGTGGCTACTTCTGTGGAAGCAGTG
  CTGTAGTTACTGGAAGATAAAAGGGAAAGCAAGCCCTTGGTGGGGGAAAGTATGGCTGCG
  ATGATGGCATTTCTTAGGACACCTTTGGATTAATAATGAAAACAACTACTCTCTGAGCAG
  CTGTTCGAATCATCTGATATTTATACTGAATGAGTTACTGTAAGTACGTATTGACAGAAT
  TACACTGTACTTTCCTCTAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCGGAG
  AACCCCACGAAATCATGCAAATCAAGAGGTTCCAATCTTCGTGTTCACTTTAAGAACACT
  CGTGAAACTGCTCAGGCCATCAAGGGTATGCATATACGAAAAGCCACGAAGTATCTGAAA
  GATGTCACTTTACAGAAACAGTGTGTACCATTCCGACGTTACAATGGTGGAGTTGGCAGG
  TGTGCGCAGGCCAAGCAATGGGGCTGGACACAAGGTCGGTGGCCCAAAAAGAGTGCTGAA
  TTTTTGCTGCACATGCTTAAAAACGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTA
  GATTCTCTGGTCATTGAGCATATCCAAGTGAACAAAGCACCTAAGATGCGCCGCCGGACC
  TACAGAGCTCATGGTCGGATTAACCCATACATGAGCTCTCCCTGCCACATTGAGATGATC
  CTTACGGAAAAGGAACAGATTGTTCCTAAACCAGAAGAGGAGGTTGCCCAGAAGAAAAAG
  ATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCACGGGAGTAAATTCAGCATTAA
  AATAAATGTAATTAAAAGGAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_000985
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000985.3, NP_000976.1
• RefSeq Size: 942 bp
• RefSeq ORF: 555 bp
• Locus ID: 6139
• Cytogenetics: 18q21.1
• Domains: Ribosomal_L22
• Protein Pathways: Ribosome
• Gene Summary: 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L22P family of ribosomal proteins. It is located in the cytoplasm. This gene has been referred to as rpL23 because the encoded protein shares amino acid identity with ribosomal protein L23 from Halobacterium marismortui; however, its official symbol is RPL17. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream C18orf32 (chromosome 18 open reading frame 32) gene. [provided by RefSeq, Dec 2010]'
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1-7 all encode isoform a.