ERAB (HSD17B10) (NM_004493) Human Untagged Clone

CAT#: SC320588

HSD17B10 (untagged)-Human hydroxysteroid (17-beta) dehydrogenase 10 (HSD17B10), nuclear gene encoding mitochondrial protein, transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HSD17B10
• Synonyms: 17b-HSD10; ABAD; CAMR; DUPXp11.22; ERAB; HADH2; HCD2; HSD10MD; MHBD; MRPP2; MRX17; MRX31; MRXS10; SCHAD; SDR5C1
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_004493.2 GTGGCCGGCGACAAGATGGCAGCAGCGTGTCGGAGCGTGAAGGGCCTGGTGGCGGTAATA
  ACCGGAGGAGCCTCGGGCCTGGGCCTGGCCACGGCGGAGCGACTTGTGGGGCAGGGAGCC
  TCTGCTGTGCTTCTGGACCTGCCCAACTCGGGTGGGGAGGCCCAAGCCAAGAAGTTAGGA
  AACAACTGCGTTTTCGCCCCAGCCGACGTGACCTCTGAGAAGGATGTGCAAACAGCTCTG
  GCTCTAGCAAAAGGAAAGTTTGGCCGTGTGGATGTAGCTGTCAACTGTGCAGGCATCGCG
  GTGGCTAGCAAGACGTACAACTTAAAGAAGGGCCAGACCCATACCTTGGAAGACTTCCAG
  CGAGTTCTTGATGTGAATCTCATGGGCACCTTCAATGTGATCCGCCTGGTGGCTGGTGAG
  ATGGGCCAGAATGAACCAGACCAGGGAGGCCAACGTGGGGTCATCATCAACACTGCCAGT
  GTGGCTGCCTTCGAGGGTCAGGTTGGACAAGCTGCATACTCTGCTTCCAAGGGGGGAATA
  GTGGGCATGACACTGCCCATTGCTCGGGATCTGGCTCCCATAGGTATCCGGGTGATGACC
  ATTGCCCCAGGTCTGTTTGGCACCCCACTGCTGACCAGCCTCCCAGAGAAAGTGTGCAAC
  TTCTTGGCCAGCCAAGTGCCCTTCCCTAGCCGACTGGGTGACCCTGCTGAGTATGCTCAC
  CTCGTACAGGCCATCATCGAGAACCCATTCCTCAATGGAGAGGTCATCCGGCTGGATGGG
  GCCATTCGTATGCAGCCTTGAAGGGAGAAGGCAGAGAAAACACACGCTCCTCTGCCCTTC
  CTTTCCCTGGGGTACTACTCTCCAGCTTGGGAGGAAGCCCAGTAGCCATTTTGTAACTGC
  CTACCAGTCGCCCTCTGTGCCTAATAAAGTCTCTTTTTCTCACAAAAAAAAAAAAAAAAA
  A
• Restriction Sites: Please inquire
• ACCN: NM_004493
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_004493.2, NP_004484.1
• RefSeq Size: 963 bp
• RefSeq ORF: 786 bp
• Locus ID: 3028
• Cytogenetics: Xp11.22
• Domains: adh_short
• Protein Families: Druggable Genome
• Protein Pathways: Alzheimer's disease, Metabolic pathways, Valine, leucine and isoleucine degradation
• Gene Summary: 'This gene encodes 3-hydroxyacyl-CoA dehydrogenase type II, a member of the short-chain dehydrogenase/reductase superfamily. The gene product is a mitochondrial protein that catalyzes the oxidation of a wide variety of fatty acids and steroids, and is a subunit of mitochondrial ribonuclease P, which is involved in tRNA maturation. The protein has been implicated in the development of Alzheimer disease, and mutations in the gene are the cause of 17beta-hydroxysteroid dehydrogenase type 10 (HSD10) deficiency. Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Aug 2014]'
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).