RCN2 (NM_002902) Human Untagged Clone
CAT#: SC320668
RCN2 (untagged)-Human reticulocalbin 2, EF-hand calcium binding domain (RCN2)
"NM_002902" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RCN2 |
Synonyms | E6BP; ERC-55; ERC55; TCBP49 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002902.1
GGCCCGGGCCCCCGCCAGCCTCCCTCCTCGCGTCCCTCGGTGTCCTCCGCGGGCCGGCGC
GATGCGGCTGGGCCCGAGGACCGCGGCGTTGGGGCTGCTGCTGCTGTGCGCCGCCGCGGC CGGCGCCGGCAAGGCCGAGGAGCTGCACTACCCGCTGGGCGAGCGCCGCAGCGACTACGA CCGCGAGGCGCTGCTGGGCGTCCAGGAAGATGTGGATGAATATGTTAAACTCGGCCACGA AGAGCAGCAAAAAAGACTGCAGGCGATCATAAAGAAAATCGACTTGGACTCAGATGGCTT TCTCACTGAAAGTGAACTCAGTTCATGGATTCAGATGTCTTTTAAGCATTATGCTATGCA AGAAGCAAAACAACAGTTTGTTGAATATGATAAAAACAGTGATGATACTGTGACTTGGGA TGAATATAACATTCAGATGTATGATCGTGTGATTGACTTTGATGAGAACACTGCTCTGGA TGATGCAGAAGAGGAGTCCTTTAGGAAGCTTCACTTAAAGGACAAGAAGCGATTTGAAAA AGCTAACCAGGATTCAGGTCCCGGTTTGAGTCTTGAAGAATTTATTGCTTTTGAGCATCC TGAAGAAGTTGATTATATGACGGAATTTGTCATTCAAGAAGCTTTAGAAGAACATGACAA AAATGGTGATGGATTTGTTAGTTTGGAAGAATTTCTTGGTGATTACAGGTGGGATCCAAC TGCAAATGAAGATCCAGAATGGATACTTGTTGAGAAAGACAGATTCGTGAATGATTATGA CAAAGATAACGATGGCAGGCTTGATCCCCAAGAGCTGTTACCTTGGGTAGTACCTAATAA TCAGGGCATTGCACAAGAGGAGGCACTTCATCTAATTGATGAAATGGATTTGAATGGTGA CAAAAAGCTCTCTGAAGAAGAGATTCTGGAAAACCCGGACTTGTTTCTCACCAGTGAAGC CACAGATTATGGCAGACAGCTCCATGATGACTATTTCTATCATGATGAGCTTTAATCTCC GAGCCTGTCTCAGTAGAGTACTGGCTCCTTTTATAATTTGTTACCAGCTTTACTTTTGTG ATAAAATATTGATGTTGTATTTTACACTCTTAAGTCTTAACCACAGTCAGAATTATCTTA ATGTAGATTATAATTTTGGTCTTTTAGGAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002902 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002902.1, NP_002893.1 |
RefSeq Size | 1700 bp |
RefSeq ORF | 954 bp |
Locus ID | 5955 |
Cytogenetics | 15q24.3 |
Domains | EFh |
Gene Summary | 'The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]' Transcript Variant: This variant (1) is a predominant transcript and encodes isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC118340 | RCN2 (untagged)-Human reticulocalbin 2, EF-hand calcium binding domain (RCN2) |
USD 310.00 |
|
RC200429 | RCN2 (Myc-DDK-tagged)-Human reticulocalbin 2, EF-hand calcium binding domain (RCN2) |
USD 98.00 |
|
RG200429 | RCN2 (GFP-tagged) - Human reticulocalbin 2, EF-hand calcium binding domain (RCN2) |
USD 460.00 |
|
RC200429L3 | Lenti ORF clone of Human reticulocalbin 2, EF-hand calcium binding domain (RCN2), Myc-DDK-tagged |
USD 768.00 |
|
RC200429L4 | Lenti ORF clone of Human reticulocalbin 2, EF-hand calcium binding domain (RCN2), mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review