NUDT2 (NM_147172) Human Untagged Clone

CAT#: SC320691

NUDT2 (untagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 2 (NUDT2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NUDT2
• Synonyms: APAH1
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_147172.1 TCGGTGCGTTTGCTTCTGAGGATCTCCAGTGTCACAACAAACACATGCCAGCCCTGTTTT
  ACAGGGAGCCCTGGAGGAGTTGGGATAGAGGCCACATTGACTGAGGGTAGTTGCCAGGGT
  CCTGCAGTTATACACAAAGTCCTTAGGATAAGACCATGGCCTTGAGAGCATGTGGCTTGA
  TCATCTTCCGAAGATGCCTCATTCCCAAAGTGGACAACAATGCAATTGAGTTTTTACTGC
  TGCAGGCATCAGATGGCATTCATCACTGGACTCCTCCCAAAGGCCATGTGGAACCAGGAG
  AGGATGACTTGGAAACAGCCCTGAGGGAGACCCAAGAGGAAGCAGGCATAGAAGCAGGCC
  AGCTGACCATTATTGAGGGGTTCAAAAGGGAACTCAATTATGTGGCCAGGAACAAGCCTA
  AAACAGTCATTTACTGGCTGGCGGAGGTGAAGGACTATGACGTGGAGATCCGCCTCTCCC
  ATGAGCACCAAGCCTACCGCTGGCTGGGGCTGGAGGAGGCCTGCCAGTTGGCTCAGTTCA
  AGGAGATGAAGGCAGCGCTCCAAGAAGGACACCAGTTTCTTTGCTCCATAGAGGCCTGAG
  CTGACTGGAGCAGAGTCATTTGCTTCAGCAGGATCCTTGTGGGCCTTCTAAGATGAAGCC
  ACCCTCAGGTCCAGGGAAGGTTGTGCTGGTATTTGGCTCATGACAGCCAAGAGCAGATTT
  GTGAAATCGGCTCAACTCCCAGGTGAGAGCAAGCAAAAATCTTGGCTGGGTGGAAAGGAA
  GGCAAAAGAGTAAAAATTAAAAAGGCCAGGCCCAGTAAGTGTACCTTGTACTTTATAAAT
  AAACCTCAAGCAGCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  AAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_147172
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_147172.1, NP_671701.1
• RefSeq Size: 989 bp
• RefSeq ORF: 444 bp
• Locus ID: 318
• Cytogenetics: 9p13.3
• Domains: NUDIX
• Protein Pathways: Purine metabolism, Pyrimidine metabolism
• Gene Summary: 'This gene encodes a member of the MutT family of nucleotide pyrophosphatases, a subset of the larger NUDIX hydrolase family. The gene product possesses a modification of the MutT sequence motif found in certain nucleotide pyrophosphatases. The enzyme asymmetrically hydrolyzes Ap4A to yield AMP and ATP and is responsible for maintaining the intracellular level of the dinucleotide Ap4A, the function of which has yet to be established. This gene may be a candidate tumor suppressor gene. Alternative splicing has been observed at this locus and four transcript variants, all encoding the same protein, have been identified. [provided by RefSeq, Sep 2011]'
  Transcript Variant: This variant (2) uses an alternate splice site on a 5' non-coding exon, compared to variant 1. All four variants encode the same protein.