NUDT2 (NM_147172) Human Untagged Clone
CAT#: SC320691
NUDT2 (untagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 2 (NUDT2), transcript variant 2
"NM_147172" in other vectors (5)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NUDT2 |
Synonyms | APAH1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_147172.1
TCGGTGCGTTTGCTTCTGAGGATCTCCAGTGTCACAACAAACACATGCCAGCCCTGTTTT
ACAGGGAGCCCTGGAGGAGTTGGGATAGAGGCCACATTGACTGAGGGTAGTTGCCAGGGT CCTGCAGTTATACACAAAGTCCTTAGGATAAGACCATGGCCTTGAGAGCATGTGGCTTGA TCATCTTCCGAAGATGCCTCATTCCCAAAGTGGACAACAATGCAATTGAGTTTTTACTGC TGCAGGCATCAGATGGCATTCATCACTGGACTCCTCCCAAAGGCCATGTGGAACCAGGAG AGGATGACTTGGAAACAGCCCTGAGGGAGACCCAAGAGGAAGCAGGCATAGAAGCAGGCC AGCTGACCATTATTGAGGGGTTCAAAAGGGAACTCAATTATGTGGCCAGGAACAAGCCTA AAACAGTCATTTACTGGCTGGCGGAGGTGAAGGACTATGACGTGGAGATCCGCCTCTCCC ATGAGCACCAAGCCTACCGCTGGCTGGGGCTGGAGGAGGCCTGCCAGTTGGCTCAGTTCA AGGAGATGAAGGCAGCGCTCCAAGAAGGACACCAGTTTCTTTGCTCCATAGAGGCCTGAG CTGACTGGAGCAGAGTCATTTGCTTCAGCAGGATCCTTGTGGGCCTTCTAAGATGAAGCC ACCCTCAGGTCCAGGGAAGGTTGTGCTGGTATTTGGCTCATGACAGCCAAGAGCAGATTT GTGAAATCGGCTCAACTCCCAGGTGAGAGCAAGCAAAAATCTTGGCTGGGTGGAAAGGAA GGCAAAAGAGTAAAAATTAAAAAGGCCAGGCCCAGTAAGTGTACCTTGTACTTTATAAAT AAACCTCAAGCAGCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_147172 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_147172.1, NP_671701.1 |
RefSeq Size | 989 bp |
RefSeq ORF | 444 bp |
Locus ID | 318 |
Cytogenetics | 9p13.3 |
Domains | NUDIX |
Protein Pathways | Purine metabolism, Pyrimidine metabolism |
Gene Summary | 'This gene encodes a member of the MutT family of nucleotide pyrophosphatases, a subset of the larger NUDIX hydrolase family. The gene product possesses a modification of the MutT sequence motif found in certain nucleotide pyrophosphatases. The enzyme asymmetrically hydrolyzes Ap4A to yield AMP and ATP and is responsible for maintaining the intracellular level of the dinucleotide Ap4A, the function of which has yet to be established. This gene may be a candidate tumor suppressor gene. Alternative splicing has been observed at this locus and four transcript variants, all encoding the same protein, have been identified. [provided by RefSeq, Sep 2011]' Transcript Variant: This variant (2) uses an alternate splice site on a 5' non-coding exon, compared to variant 1. All four variants encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC108939 | NUDT2 (untagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 2 (NUDT2), transcript variant 2 |
USD 310.00 |
|
RC202439 | NUDT2 (Myc-DDK-tagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 2 (NUDT2), transcript variant 2 |
USD 98.00 |
|
RG202439 | NUDT2 (GFP-tagged) - Human nudix (nucleoside diphosphate linked moiety X)-type motif 2 (NUDT2), transcript variant 2 |
USD 460.00 |
|
RC202439L3 | Lenti ORF clone of Human nudix (nucleoside diphosphate linked moiety X)-type motif 2 (NUDT2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC202439L4 | Lenti ORF clone of Human nudix (nucleoside diphosphate linked moiety X)-type motif 2 (NUDT2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review