FXYD2 (NM_021603) Human Untagged Clone

CAT#: SC320832

FXYD2 (untagged)-Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b


  "NM_021603" in other vectors (7)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "FXYD2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FXYD2
Synonyms ATP1G1; HOMG2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_021603.2 GCCACTCTCCATCCAGGCCCCAGGCAAGCAGCACCTCCCTGCTCTTCTGCACTCCTGGAC
ACAACCAGCAGCTCCTGCCATGGACAGGTGGTACCTGGGCGGCAGCCCCAAGGGGGACGT
GGACCCGTTCTACTATGACTATGAGACCGTTCGCAATGGGGGCCTGATCTTCGCTGGACT
GGCCTTCATCGTGGGGCTCCTCATCCTCCTCAGCAGAAGATTCCGCTGTGGGGGCAATAA
GAAGCGCAGGCAAATCAATGAAGATGAGCCGTAACAGCAGCCTCGGCGGTGCCACCCACT
GCACTGGGGCCAGCTGGGAAGCCAAGCATGGCCCTGCCTCTGGCGCCTCCCCTTCTTCCC
TGGGCTTTAGACCTTTGTCCCCGTCACTGCCAGCGCTTGGGCTGAAGGAAGCTCCAGACT
CAATGTGACCCCCAGGTGGCATCGCCAACGCCTGCCTCGTGCCACCTCATGCTTATAATA
AAGCCGGCGTCAGAGACCGCTGCTTCCCTCACCAAAAAAATAAAAAAAAAAAAAAAAAAA
AAAAAAA
Restriction Sites Please inquire     
ACCN NM_021603
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021603.2, NP_067614.1
RefSeq Size 578 bp
RefSeq ORF 195 bp
Locus ID 486
Cytogenetics 11q23.3
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
Gene Summary 'This gene encodes a member of the FXYD family of transmembrane proteins. This particular protein encodes the sodium/potassium-transporting ATPase subunit gamma. Mutations in this gene have been associated with Renal Hypomagnesemia-2. Alternatively spliced transcript variants have been described. Read-through transcripts have been observed between this locus and the upstream FXYD domain-containing ion transport regulator 6 (FXYD6, GeneID 53826) locus.[provided by RefSeq, Feb 2011]'
Transcript Variant: This variant (b) contains an alternate 5' terminal exon compared to transcript variant a, resulting in a slightly shorter isoform (2) with a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.