RPLP2 (NM_001004) Human Untagged Clone

CAT#: SC320833

RPLP2 (untagged)-Human ribosomal protein, large, P2 (RPLP2)


  "NM_001004" in other vectors (5)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "RPLP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPLP2
Synonyms D11S2243E; LP2; P2; RPP2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001004.3 TTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGC
CGCAGACGCCGCCGCGATGCGCTACGTCGCCTCCTACCTGCTGGCTGCCCTAGGGGGCAA
CTCCTCCCCCAGCGCCAAGGACATCAAGAAGATCTTGGACAGCGTGGGTATCGAGGCGGA
CGACGACCGGCTCAACAAGGTTATCAGTGAGCTGAATGGAAAAAACATTGAAGACGTCAT
TGCCCAGGGTATTGGCAAGCTTGCCAGTGTACCTGCTGGTGGGGCTGTAGCCGTCTCTGC
TGCCCCAGGCTCTGCAGCCCCTGCTGCTGGTTCTGCCCCTGCTGCAGCAGAGGAGAAGAA
AGATGAGAAGAAGGAGGAGTCTGAAGAGTCAGATGATGACATGGGATTTGGCCTTTTTGA
TTAAATTCCTGCTCCCCTGCAAATAAAGCCTTTTTACACATCTAAAAAAAAAAAAAAAAA
AAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001004
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001004.3, NP_000995.1
RefSeq Size 511 bp
RefSeq ORF 348 bp
Locus ID 6181
Cytogenetics 11p15.5
Domains 60s_ribosomal
Protein Families Druggable Genome
Protein Pathways Ribosome
Gene Summary 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P1. The P2 protein can interact with P0 and P1 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.