Stathmin 1 (STMN1) (NM_203401) Human Untagged Clone

CAT#: SC321093

STMN1 (untagged)-Human stathmin 1 (STMN1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: STMN1
• Synonyms: C1orf215; Lag; LAP18; OP18; PP17; PP19; PR22; SMN
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_203401 edited
  GGGGGGTGCCTCTGTTTGGCGCTTTTGTGCGCGCCCGGGTCTGTTGGTGCTCAGAGTGTG
  GTCAGGCGGCTCGGACTGAGCAGGACTTTCCTTATCCCAGTTGATTGTGCAGAATACACT
  GCCTGTCGCTTGTCTTCTATTCACCATGGCTTCTTCTGATATCCAGGTGAAAGAACTGGA
  GAAGCGTGCCTCAGGCCAGGCTTTTGAGCTGATTCTCAGCCCTCGGTCAAAAGAATCTGT
  TCCAGAATTCCCCCTTTCCCCTCCAAAGAAGAAGGATTTTTCCCTGGAGGAAATTCAGAA
  GAAATTAGAAGCTGCAGAAGAAAGACGCAAGTCCCATGAAGCTGAGGTCTTGAAGCAGCT
  GGCTGAGAAACGAGAGCACGAGAAAGAAGTGCTTCAGAAGGCAATAGAAGAGAACAACAA
  CTTCAGTAAAATGGCAGAAGAGAAACTGACCCACAAAATGGAAGCTAATAAAGAGAACCG
  AGAGGCACAAATGGCTGCCAAACTGGAACGTTTGCGAGAGAAGGATAAGCACATTGAAGA
  AGTGCGGAAGAACAAAGAATCCAAAGACCCTGCTGACGAGACTGAAGCTGACTAATTTGT
  TCTGAGAACTGACTTTCTCCCCATCCCCTTCCTAAATATCCAAAGACTGTACTGGCCAGT
  GTCATTTTATTTTTTCCCTCCTGACAAATATTTTAGAAGCTAATGTAGGACTGTATAGGT
  AGATCCAGATCCAGACTGTAAGATGTTGTTTTAGGGGCTAAAGGGGAGAAACTGAAAGTG
  TTTTACTCTTTTTCTAAAGTGTTGGTCTTTCTAATGTAGCTATTTTTCTTGTTGCATCTT
  TTCTACTTCAGTACACTTGGTGTACTGGGTTAATGGCTAGTACTGTATTGGCTCTGTGAA
  AACATATTTGTGAAAAGAGTATGTAGTGGCTCCTTTTGAACTGTTAGATGCTGAATATCT
  GTTCACTTTTCAATCCCAATTCTGTCCCAATCTTACCAGATGCTACTGGACTTGAATGGT
  TAATAAGACTGCACAGTGCTGTAAAAAAAAAAAAAAAAAAAAAAAAAAA
  
• Restriction Sites: Please inquire
• ACCN: NM_203401
• Insert Size: 1100 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_203401.1, NP_981946.1
• RefSeq Size: 1730 bp
• RefSeq ORF: 450 bp
• Locus ID: 3925
• Cytogenetics: 1p36.11
• Protein Pathways: MAPK signaling pathway
• Gene Summary: 'This gene belongs to the stathmin family of genes. It encodes a ubiquitous cytosolic phosphoprotein proposed to function as an intracellular relay integrating regulatory signals of the cellular environment. The encoded protein is involved in the regulation of the microtubule filament system by destabilizing microtubules. It prevents assembly and promotes disassembly of microtubules. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]'
  Transcript Variant: This variant (1) differs in the 5' UTR and uses an alternate terminal exon, compared to variant 4. The resulting isoform (a) has a shorter and distinct C-terminus, compared to isoform b. Variants 1, 2, and 3 encode the same protein.