Sumo 1 (SUMO1) (NM_003352) Human Untagged Clone
CAT#: SC321415
SUMO1 (untagged)-Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1
"NM_003352" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SUMO1 |
Synonyms | DAP1; GMP1; OFC10; PIC1; SENP2; SMT3; SMT3C; SMT3H3; UBL1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_003352.4
CGTAGCGGAAGTTACTGCAGCCGCGGTGTTGTGCTGTGGGGAAGGGAGAAGGATTTGTAA
ACCCCGGAGCGAGGTTCTGCTTACCCGAGGCCGCTGCTGTGCGGAGACCCCCGGGTGAAG CCACCGTCATCATGTCTGACCAGGAGGCAAAACCTTCAACTGAGGACTTGGGGGATAAGA AGGAAGGTGAATATATTAAACTCAAAGTCATTGGACAGGATAGCAGTGAGATTCACTTCA AAGTGAAAATGACAACACATCTCAAGAAACTCAAAGAATCATACTGTCAAAGACAGGGTG TTCCAATGAATTCACTCAGGTTTCTCTTTGAGGGTCAGAGAATTGCTGATAATCATACTC CAAAAGAACTGGGAATGGAGGAAGAAGATGTGATTGAAGTTTATCAGGAACAAACGGGGG GTCATTCAACAGTTTAGATATTCTTTTTATTTTTTTTTCTTTTCCCTCAATCCTTTTTTA TTTTTAAAAATAGTTCTTTTGTAATGTGGTGTTCAAAACGGAATTGAAAACTGGCACCCC ATCTCTTTGAAACATCTGGTAATTTGAATTCTAGTGCTCATTATTCATTATTGTTTGTTT TCATTGTGCTGATTTTTGGTGATCAAGCCTCAGTCCCCTTCATATTACCCTCTCCTTTTT AAAAATTACGTGTGCACAGAGAGGTCACCTTTTTCAGGACATTGCATTTTCAGGCTTGTG GTGATAAATAAGATCGACCAATGCAAGTGTTCATAATGACTTTCCAATTGGCCCTGATGT TCTAGCATGTGATTACTTCACTCCTGGACTGTGACTTTCAGTGGGAGATGGAAGTTTTTC AGAGAACTGAACTGTGGAAAAATGACCTTTCCTTAACTTGAAGCTACTTTTAAAATTTGA GGGTCTGGACCAAAAGAAGAGGAATATCAGGTTGAAGTCAAGATGACAGATAAGGTGAGA GTAATGACTAACTCCAAAGATGGCTTCACTGAAGAAAAGGCATTTTAAGATTTTTTAAAA ATCTTGTCAGAAGATCCCAGAAAAGTTCTAATTTTCATTAGCAATTAATAAAGCTATACA TGCAGAAATGAATACAACAGAACACTGCTCTTTTTGATTTTATTTGTACTTTTTGGCCTG GGATATGGGTTTTAAATGGACATTGTCTGTACCAGCTTCATTAAAATAAACAATATTTGT AAAAATCAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_003352 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_003352.4, NP_003343.1 |
RefSeq Size | 1527 bp |
RefSeq ORF | 306 bp |
Locus ID | 7341 |
Cytogenetics | 2q33.1 |
Domains | UBQ |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
Gene Summary | 'This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last four amino acids of the carboxy-terminus have been cleaved off. Several pseudogenes have been reported for this gene. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200633 | SUMO1 (Myc-DDK-tagged)-Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1 |
USD 98.00 |
|
RG200633 | SUMO1 (GFP-tagged) - Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1 |
USD 460.00 |
|
RC200633L1 | Lenti ORF clone of Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC200633L2 | Lenti ORF clone of Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC200633L3 | Lenti ORF clone of Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC200633L4 | Lenti ORF clone of Human SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) (SUMO1), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review