RHOA (NM_001664) Human Untagged Clone
CAT#: SC321534
RHOA (untagged)-Human ras homolog gene family, member A (RHOA)
"NM_001664" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | RHOA |
| Synonyms | ARH12; ARHA; RHO12; RHOH12 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001664.2
GTTCTCTCGTTAGTCCACGGTCTGGTCTTCAGCTACCCGCCTTCGTCTCCGAGTTTGCGA
CTCGCGGACCGGCGTCCCCGGCGCGAAGAGGCTGGACTCGGATTCGTTGCCTGAGCAATG GCTGCCATCCGGAAGAAACTGGTGATTGTTGGTGATGGAGCCTGTGGAAAGACATGCTTG CTCATAGTCTTCAGCAAGGACCAGTTCCCAGAGGTGTATGTGCCCACAGTGTTTGAGAAC TATGTGGCAGATATCGAGGTGGATGGAAAGCAGGTAGAATTGGCTTTGTGGGACACAGCT GGGCAGGAAGATTATGATCGCCTGAGGCCCCTCTCCTACCCAGATACCGATGTTATACTG ATGTGTTTTTCCATCGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAGTGGACCCCA GAAGTCAAGCATTTCTGTCCCAACGTGCCCATCATCCTGGTTGGGAATAAGAAGGATCTT CGGAATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTGAAACCT GAAGAAGGCAGAGATATGGCAAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCAGCA AAGACCAAAGATGGAGTGAGAGAGGTTTTTGAAATGGCTACGAGAGCTGCTCTGCAAGCT AGACGTGGGAAGAAAAAATCTGGGTGCCTTGTCTTGTGAAACCTTGCTGCAAGCACAGCC CTTATGCGGTTAATTTTGAAGTGCTGTTTATTAATCTTAGTGTATGATTACTGGCCTTTT TCATTTATCTATAATTTACCTAAGATTACAAATCAGAAGTCATCTTGCTACCAGTATTTA GAAGCCAACTATGATTATTAACGATGTCCAACCCGTCTGGCCCACCAGGGTCCTTTTGAC ACTGCTCTAACAGCCCTCCTCTGCACTCCCACCTGACACACCAGGCGCTAATTCAAGGAA TTTCTTAACTTCTTGCTTCTTTCTAGAAAGAGAAACAGTTGGTAACTTTTGTGAATTAGG CTGTAACTACTTTATAACTAACATGTCCTGCCTATTATCTGTCAGCTGCAAGGTACTCTG GTGAGTCACCACTTCAGGGCTTTACTCCGTAACAGATTTTGTTGGCATAGCTCTGGGGTG GGCAGTTTTTTGAAAATGGGCTCAACCAGAAAAGCCCAAGTTCATGCAGCTGTGGCAGAG TTACAGTTCTGTGGTTTCATGTTAGTTACCTTATAGTTACTGTGTAATTAGTGCCACTTA ATGTATGTTACCAAAAATAAATATATCTACCCCAGACTAGATGTAGTATTTTTTGTATAA TTGGATTTCCTAATACTGTCATCCTCAAAGAAAGTGTATTGGTTTTTTAAAAAAGAAAGT GTATTTGGAAATAAAGTCAGATGGAAAATTTAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001664 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001664.2, NP_001655.1 |
| RefSeq Size | 1926 bp |
| RefSeq ORF | 582 bp |
| Locus ID | 387 |
| Cytogenetics | 3p21.31 |
| Domains | ras, RAS, RHO, RAB |
| Protein Families | Druggable Genome |
| Protein Pathways | Adherens junction, Axon guidance, Chemokine signaling pathway, Focal adhesion, Leukocyte transendothelial migration, Neurotrophin signaling pathway, Pathogenic Escherichia coli infection, Pathways in cancer, Regulation of actin cytoskeleton, T cell receptor signaling pathway, TGF-beta signaling pathway, Tight junction, Vascular smooth muscle contraction, Wnt signaling pathway |
| Gene Summary | 'This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. Overexpression of this gene is associated with tumor cell proliferation and metastasis. Multiple alternatively spliced variants have been identified. [provided by RefSeq, Sep 2015]' Transcript Variant: This variant (1) encodes the longest isoform (1). Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203303 | RHOA (Myc-DDK-tagged)-Human ras homolog gene family, member A (RHOA) |
USD 450.00 |
|
| RG203303 | RHOA (GFP-tagged) - Human ras homolog gene family, member A (RHOA) |
USD 460.00 |
|
| RC203303L1 | Lenti ORF clone of Human ras homolog gene family, member A (RHOA), Myc-DDK-tagged |
USD 768.00 |
|
| RC203303L2 | Lenti ORF clone of Human ras homolog gene family, member A (RHOA), mGFP tagged |
USD 620.00 |
|
| RC203303L3 | Lenti ORF clone of Human ras homolog gene family, member A (RHOA), Myc-DDK-tagged |
USD 620.00 |
|
| RC203303L4 | Lenti ORF clone of Human ras homolog gene family, member A (RHOA), mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China