14-3-3 beta (YWHAB) (NM_139323) Human Untagged Clone

CAT#: SC321550

YWHAB (untagged)-Human tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide (YWHAB), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: YWHAB
• Synonyms: GW128; HEL-S-1; HS1; KCIP-1; YWHAA
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_139323.2 GTGGAGCTACCGCCACCGCCGCCGCCGATTCCGGAGCCGGGGTAGTCGCCGCCGCCGCCG
  CCGCTGCAGCCACTGCAGGCACCGCTGCCGCCGCCTGAGTAGTGGGCTTAGGAAGGAAGA
  GGTCATCTCGCTCGGAGCTTCGCTCGGAAGGGTCTTTGTTCCCTGCAGCCCTCCCACGGG
  AATGACAATGGATAAAAGTGAGCTGGTACAGAAAGCCAAACTCGCTGAGCAGGCTGAGCG
  ATATGATGATATGGCTGCAGCCATGAAGGCAGTCACAGAACAGGGGCATGAACTCTCCAA
  CGAAGAGAGAAATCTGCTCTCTGTTGCCTACAAGAATGTGGTAGGCGCCCGCCGCTCTTC
  CTGGCGTGTCATCTCCAGCATTGAGCAGAAAACAGAGAGGAATGAGAAGAAGCAGCAGAT
  GGGCAAAGAGTACCGTGAGAAGATAGAGGCAGAACTGCAGGACATCTGCAATGATGTTCT
  GGAGCTGTTGGACAAATATCTTATTCCCAATGCTACACAACCAGAAAGTAAGGTGTTCTA
  CTTGAAAATGAAAGGAGATTATTTTAGGTATCTTTCTGAAGTGGCATCTGGAGACAACAA
  ACAAACCACTGTGTCGAACTCCCAGCAGGCTTACCAGGAAGCATTTGAAATTAGTAAGAA
  AGAAATGCAGCCTACACACCCAATTCGTCTTGGTCTGGCACTAAATTTCTCAGTCTTTTA
  CTATGAGATTCTAAACTCTCCTGAAAAGGCCTGTAGCCTGGCAAAAACGGCATTTGATGA
  AGCAATTGCTGAATTGGATACGCTGAATGAAGAGTCTTATAAAGACAGCACTCTGATCAT
  GCAGTTACTTAGGGACAATCTCACTCTGTGGACATCGGAAAACCAGGGAGACGAAGGAGA
  CGCTGGGGAGGGAGAGAACTAATGTTTCTCGTGCTTTGTGATCTGTTCAGTGTCACTCTG
  TACCCTCAACATATATCCCTTGTGCGATAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_139323
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_139323.2, NP_647539.1
• RefSeq Size: 3015 bp
• RefSeq ORF: 741 bp
• Locus ID: 7529
• Cytogenetics: 20q13.12
• Domains: 14-3-3
• Protein Families: Druggable Genome
• Protein Pathways: Cell cycle, Neurotrophin signaling pathway, Oocyte meiosis
• Gene Summary: 'This gene encodes a protein belonging to the 14-3-3 family of proteins, members of which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals. The encoded protein has been shown to interact with RAF1 and CDC25 phosphatases, suggesting that it may play a role in linking mitogenic signaling and the cell cycle machinery. Two transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) lacks an exon in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.