HLA DM (HLA-DMA) (NM_006120) Human Untagged Clone

CAT#: SC321601

HLA (untagged)-Human major histocompatibility complex, class II, DM alpha (HLA-DMA)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HLA-DMA
• Synonyms: D6S222E; DMA; HLADM; RING6
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_006120.2 GGGGGGGGAAGCTGGGTTGGCTGGGTTGGTAGCTCCTACCTACTGTGTGGCAAGAAGGTA
  TGGGTCATGAACAGAACCAAGGAGCTGCGCTGCTACAGATGTTACCACTTCTGTGGCTGC
  TACCCCACTCCTGGGCCGTCCCTGAAGCTCCTACTCCAATGTGGCCAGATGACCTGCAAA
  ACCACACATTCCTGCACACAGTGTACTGCCAGGATGGGAGTCCCAGTGTGGGACTCTCTG
  AGGCCTACGACGAGGACCAGCTTTTCTTCTTCGACTTTTCCCAGAACACTCGGGTGCCTC
  GCCTGCCCGAATTTGCTGACTGGGCTCAGGAACAGGGAGATGCTCCTGCCATTTTATTTG
  ACAAAGAGTTCTGCGAGTGGATGATCCAGCAAATAGGGCCAAAACTTGATGGGAAAATCC
  CGGTGTCCAGAGGGTTTCCTATCGCTGAAGTGTTCACGCTGAAGCCCCTGGAGTTTGGCA
  AGCCCAACACTTTGGTCTGTTTTGTCAGTAATCTCTTCCCACCCATGCTGACAGTGAACT
  GGCAGCATCATTCCGTCCCTGTGGAAGGATTTGGGCCTACTTTTGTCTCAGCTGTCGATG
  GACTCAGCTTCCAGGCCTTTTCTTACTTAAACTTCACACCAGAACCTTCTGACATTTTCT
  CCTGCATTGTGACTCACGAAATTGACCGCTACACAGCAATTGCCTATTGGGTACCCCGGA
  ACGCACTGCCCTCAGATCTGCTGGAGAATGTGCTGTGTGGCGTGGCCTTTGGCCTGGGTG
  TGCTGGGCATCATCGTGGGCATTGTTCTCATCATCTACTTCCGGAAGCCTTGCTCAGGTG
  ACTGATTCTTCCAGACCAGAGTTTGATGCCAGCAGCTTCGGCCATCCAAACAGAGGATGC
  TCAGATTTCTCACATCCTGCCCAGGATCTCCTCTTAGGGTAGAAGAAGTCTCTGGGACAT
  CCCTGGGGTGTGTGTGTAGATTTCCCACCTGGGGACTCTGCTGTCCCTGGGCTTGCATCC
  CAGGGATCCCAGAGTGGCCTGCCTATCACAACCACATCCCTTCCCCCCACAAGGCAATAA
  ATCTCATTTCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_006120
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_006120.2, NP_006111.2
• RefSeq Size: 1100 bp
• RefSeq ORF: 786 bp
• Locus ID: 3108
• Cytogenetics: 6p21.32
• Domains: MHC_II_alpha, ig, IGc1
• Protein Families: Transmembrane
• Protein Pathways: Allograft rejection, Antigen processing and presentation, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Systemic lupus erythematosus, Type I diabetes mellitus, Viral myocarditis
• Gene Summary: 'HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008]'