HAS3 (NM_138612) Human Untagged Clone
CAT#: SC321764
HAS3 (untagged)-Human hyaluronan synthase 3 (HAS3), transcript variant 2
"NM_138612" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HAS3 |
Synonyms | HA synthase 3; hyaluronan synthase 3; hyaluronic acid synthase 3; OTTHUMP00000174869 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_138612.1
GGAGGGGCATGGAGCCGCCGCGGGCCTGCTGAGCTCCGGAGCGCGGCAGCCGGCGGCACG
ATGCCGGTGCAGCTGACGACAGCCCTGCGTGTGGTGGGCACCAGCCTGTTTGCCCTGGCA GTGCTGGGTGGCATCCTGGCAGCCTATGTGACGGGCTACCAGTTCATCCACACGGAAAAG CACTACCTGTCCTTCGGCCTGTACGGCGCCATCCTGGGCCTGCACCTGCTCATTCAGAGC CTTTTTGCCTTCCTGGAGCACCGGCGCATGCGACGTGCCGGCCAGGCCCTGAAGCTGCCC TCCCCGCGGCGGGGCTCGGTGGCACTGTGCATTGCCGCGTACCAGGAGGACCCTGACTAC TTGCGCAAGTGCCTGCGCTCGGCCCAGCGCATCTCCTTCCCTGACCTCAAGGTGGTCATG GTGGTGGATGGCAACCGCCAGGAGGACGCCTACATGCTGGACATCTTCCACGAGGTGCTG GGCGGCACCGAGCAGGCCGGCTTCTTTGTGTGGCGCAGCAACTTCCATGAGGCAGGCGAG GGTGAGACGGAGGCCAGCCTGCAGGAGGGCATGGACCGTGTGCGGGATGTGGTGCGGGCC AGCACCTTCTCGTGCATCATGCAGAAGTGGGGAGGCAAGCGCGAGGTCATGTACACGGCC TTCAAGGCCCTCGGCGATTCGGTGGACTACATCCAGGTGTGCGACTCTGACACTGTGCTG GATCCAGCCTGCACCATCGAGATGCTTCGAGTCCTGGAGGAGGATCCCCAAGTAGGGGGA GTCGGGGGAGATGTCCAGCCCCCAGGGAAAGGTATGGCAGTAGAGGATGACCAGGTCCAA GCTGCCCAGGTCAGAGCTACGGAAGCATGGTCCGTTCACCAACGCCACGTTTCTAGAGAG CAGTGAGCTGATTCTCCAATGGTGAGCAGGGGACTACATGTGAACTGGGACCTGCAGGCC AATGTATCCCTGAGGAAAAGTCCACAAGAACAATTCAAGAAACTAGTAAGAAACAATGGG CAGAAAGCTGTGGGACGAAAGCACAGCAGGCTTCTGGGAGGCTGGAGATCCTTTCTCTCA AGGGCAGGATTATTCCCACCTGCCACAGTTCACATGCCACAAATAACATCTCACCTTCAG TCAAGAAAAACGCAAAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_138612 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_138612.1, NP_619515.1 |
RefSeq Size | 1229 bp |
RefSeq ORF | 846 bp |
Locus ID | 3038 |
Cytogenetics | 16q22.1 |
Protein Families | Transmembrane |
Gene Summary | 'The protein encoded by this gene is involved in the synthesis of the unbranched glycosaminoglycan hyaluronan, or hyaluronic acid, which is a major constituent of the extracellular matrix. This gene is a member of the NODC/HAS gene family. Compared to the proteins encoded by other members of this gene family, this protein appears to be more of a regulator of hyaluronan synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]' Transcript Variant: This variant (2) contains a different 5' and 3' exon as compared to variant 3. As a result, variant 2 encodes isoform b, which has the same N-terminus but is shorter and has a different C-terminus than isoform a encoded by variant 3. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205784 | HAS3 (Myc-DDK-tagged)-Human hyaluronan synthase 3 (HAS3), transcript variant 2 |
USD 420.00 |
|
RG205784 | HAS3 (GFP-tagged) - Human hyaluronan synthase 3 (HAS3), transcript variant 2 |
USD 460.00 |
|
RC205784L1 | Lenti ORF clone of Human hyaluronan synthase 3 (HAS3), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC205784L2 | Lenti ORF clone of Human hyaluronan synthase 3 (HAS3), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC205784L3 | Lenti ORF clone of Human hyaluronan synthase 3 (HAS3), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC205784L4 | Lenti ORF clone of Human hyaluronan synthase 3 (HAS3), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review