Kallikrein 7 (KLK7) (NM_005046) Human Untagged Clone
CAT#: SC321771
KLK7 (untagged)-Human kallikrein-related peptidase 7 (KLK7), transcript variant 1
"NM_005046" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | KLK7 |
| Synonyms | hK7; PRSS6; SCCE |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_005046 edited
CCAGCTGTGTGCCAGCCCAAGTCGGAACTTGGATCACATCAGATCCTCTCGAGCTCCAGC AGGAGAGGCCCTTCCTCGCCTGGCAGCCCCTGAGCGGCTCAGCAGGGCACCATGGCAAGA TCCCTTCTCCTGCCCCTGCAGATCCTACTGCTATCCTTAGCCTTGGAAACTGCAGGAGAA GAAGCCCAGGGTGACAAGATTATTGATGGCGCCCCATGTGCAAGAGGCTCCCACCCATGG CAGGTGGCCCTGCTCAGTGGCAATCAGCTCCACTGCGGAGGCGTCCTGGTCAATGAGCGC TGGGTGCTCACTGCCGCCCACTGCAAGATGAATGAGTACACCGTGCACCTGGGCAGTGAT ACGCTGGGCGACAGGAGAGCTCAGAGGATCAAGGCCTCGAAGTCATTCCGCCACCCCGGC TACTCCACACAGACCCATGTTAATGACCTCATGCTCGTGAAGCTCAATAGCCAGGCCAGG CTGTCATCCATGGTGAAGAAAGTCAGGCTGCCCTCCCGCTGCGAACCCCCTGGAACCACC TGTACTGTCTCCGGCTGGGGCACTACCACGAGCCCAGATGTGACCTTTCCCTCTGACCTC ATGTGCGTGGATGTCAAGCTCATCTCCCCCCAGGACTGCACGAAGGTTTACAAGGACTTA CTGGAAAATTCCATGCTGTGCGCTGGCATCCCCGACTCCAAGAAAAACGCCTGCAATGGT GACTCAGGGGGACCGTTGGTGTGCAGAGGTACCCTGCAAGGTCTGGTGTCCTGGGGAACT TTCCCTTGGGGCCAACCCAATGACCCAGGAGTCTACACTCAAGTGTGCAAGTTCACCAAG TGGATAAATGACACCATGAAAAAGCATCGCTAACGCCCCCCTGAGTTAATTAACTGTGTG CTTCCAACAGAAAATGCACAGGAGTGAGGACGCCGATGACCTATGAAGTCAAATTTGACT TTACCTTTCCTCAAAGATATATTTAAACCTCATGCCCTGTTGATAAACCAATCAAATTGG TAAAGACCTAAAACCAAAACAAATAAAGAAACACAAAACCCTCAGTGCTGGAGAAGAGTC AGTGAGACCAGCACTCTCAAACACTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_005046 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to have one SNP, which doesn't change amino acid. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_005046.2, NP_005037.1 |
| RefSeq Size | 1927 bp |
| RefSeq ORF | 762 bp |
| Locus ID | 5650 |
| Cytogenetics | 19q13.41 |
| Protein Families | Druggable Genome, Secreted Protein |
| Gene Summary | 'This gene encodes a member of the kallikrein subfamily of serine proteases. These enzymes have diverse physiological functions and many kallikrein genes are biomarkers for cancer. The encoded protein has chymotrypsin-like activity and plays a role in the proteolysis of intercellular cohesive structures that precedes desquamation, the shedding of the outermost layer of the epidermis. The encoded protein may play a role in cancer invasion and metastasis, and increased expression of this gene is associated with unfavorable prognosis and progression of several types of cancer. Polymorphisms in this gene may play a role in the development of atopic dermatitis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, which is one of fifteen kallikrein subfamily members located in a gene cluster on chromosome 19. [provided by RefSeq, May 2011]' Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Variants 1 and 2 encode the same isoform. Sequence Note: This RefSeq record was created from transcript sequence data to make the sequence consistent with the reference genome assembly, which represents the 'AACCAACC' allele with regards to the 3' UTR polymorphism described in PMID 15191543. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204423 | KLK7 (Myc-DDK-tagged)-Human kallikrein-related peptidase 7 (KLK7), transcript variant 1 |
USD 300.00 |
|
| RG204423 | KLK7 (GFP-tagged) - Human kallikrein-related peptidase 7 (KLK7), transcript variant 1 |
USD 460.00 |
|
| RC204423L1 | Lenti ORF clone of Human kallikrein-related peptidase 7 (KLK7), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
| RC204423L2 | Lenti ORF clone of Human kallikrein-related peptidase 7 (KLK7), transcript variant 1, mGFP tagged |
USD 620.00 |
|
| RC204423L3 | Lenti ORF clone of Human kallikrein-related peptidase 7 (KLK7), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
| RC204423L4 | Lenti ORF clone of Human kallikrein-related peptidase 7 (KLK7), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China