GTF2H3 (NM_001516) Human Untagged Clone
CAT#: SC321954
GTF2H3 (untagged)-Human general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3)
"NM_001516" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GTF2H3 |
Synonyms | BTF2; P34; TFB4; TFIIH |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC321954
GTGCTGGGACAGCCATGGTTTCAGACGAAGATGAATTGAATCTTCTGGTTATTGTAGTTG
ATGCCAACCCAATTTGGTGGGGAAAGCAAGCATTAAAGGAATCTCAGTTCACTTTATCCA AATGCATAGATGCCGTGATGGTGCTGGGAAATTCGCATTTATTCATGAATCGTTCCAACA AACTTGCTGTGATAGCAAGTCACATTCAAGAAAGCCGATTCTTATATCCTGGAAAGAATG GCAGACTTGGAGACTTCTTCGGAGACCCTGGCAACCCTCCTGAATTTAATCCCTCTGGGA GTAAAGATGGAAAATACGAACTTTTAACCTCAGCAAATGAAGTTATTGTTGAAGAGATTA AAGATCTAATGACCAAAAGTGACATAAAGGGTCAACATACAGAAACTTTGCTGGCAGGAT CCCTGGCCAAAGCCCTTTGCTACATTCATAGAATGAACAAGGAAGTTAAAGACAATCAGG AAATGAAATCAAGGATATTGGTGATTAAGGCTGCAGAAGACAGTGCGTTGCAGTATATGA ACTTCATGAATGTCATCTTTGCAGCACAGAAACAGAATATTTTGATTGATGCCTGTGTTT TAGACTCCGACTCAGGGCTCCTCCAACAGGCTTGTGACATCACGGGAGGACTGTACCTGA AGGTGCCTCAGATGCCTTCTCTTCTGCAGTATTTGCTGTGGGTGTTTCTTCCCGATCAAG ATCAGAGATCTCAGTTAATCCTCCCACCCCCGGTTCATGTTGACTACAGGGCTGCTTGCT TCTGTCATCGAAATCTCATTGAAATTGGTTATGTCTGTTCTGTGTGTTTGTCAATATTCT GCAATTTCAGCCCCATTTGTACTACGTGCGAGACAGCCTTTAAAATTTCTCTGCCTCCAG TGCTGAAAGCCAAGAAAAAGAAACTGAAAGTGTCTGCCTGAGGATAAAATATTTTCCCCA TCTTTTAGAGCTGTTAATAGAAATTATATAGCAGATTCTTTGTTGGGAAGACTGAAAAAA AAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001516 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001516.3, NP_001507.2 |
RefSeq Size | 1505 bp |
RefSeq ORF | 927 bp |
Locus ID | 2967 |
Cytogenetics | 12q24.31 |
Domains | Tfb4 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Basal transcription factors, Nucleotide excision repair |
Gene Summary | 'This gene encodes a member of the TFB4 family. The encoded protein is a subunit of the core-TFIIH basal transcription factor and localizes to the nucleus. The encoded protein is involved in RNA transcription by RNA polymerase II and nucleotide excision repair and associates with the Cdk-activating kinase complex. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 14. [provided by RefSeq, Dec 2012]' Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC119181 | GTF2H3 (untagged)-Human general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3) |
USD 310.00 |
|
RC209399 | GTF2H3 (Myc-DDK-tagged)-Human general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3) |
USD 420.00 |
|
RG209399 | GTF2H3 (GFP-tagged) - Human general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3) |
USD 460.00 |
|
RC209399L1 | Lenti ORF clone of Human general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3), Myc-DDK-tagged |
USD 620.00 |
|
RC209399L2 | Lenti ORF clone of Human general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3), mGFP tagged |
USD 620.00 |
|
RC209399L3 | Lenti ORF clone of Human general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3), Myc-DDK-tagged |
USD 620.00 |
|
RC209399L4 | Lenti ORF clone of Human general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review