GTF2H3 (NM_001516) Human Untagged Clone

CAT#: SC321954

GTF2H3 (untagged)-Human general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3)


  "NM_001516" in other vectors (7)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "GTF2H3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GTF2H3
Synonyms BTF2; P34; TFB4; TFIIH
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC321954 GTGCTGGGACAGCCATGGTTTCAGACGAAGATGAATTGAATCTTCTGGTTATTGTAGTTG
ATGCCAACCCAATTTGGTGGGGAAAGCAAGCATTAAAGGAATCTCAGTTCACTTTATCCA
AATGCATAGATGCCGTGATGGTGCTGGGAAATTCGCATTTATTCATGAATCGTTCCAACA
AACTTGCTGTGATAGCAAGTCACATTCAAGAAAGCCGATTCTTATATCCTGGAAAGAATG
GCAGACTTGGAGACTTCTTCGGAGACCCTGGCAACCCTCCTGAATTTAATCCCTCTGGGA
GTAAAGATGGAAAATACGAACTTTTAACCTCAGCAAATGAAGTTATTGTTGAAGAGATTA
AAGATCTAATGACCAAAAGTGACATAAAGGGTCAACATACAGAAACTTTGCTGGCAGGAT
CCCTGGCCAAAGCCCTTTGCTACATTCATAGAATGAACAAGGAAGTTAAAGACAATCAGG
AAATGAAATCAAGGATATTGGTGATTAAGGCTGCAGAAGACAGTGCGTTGCAGTATATGA
ACTTCATGAATGTCATCTTTGCAGCACAGAAACAGAATATTTTGATTGATGCCTGTGTTT
TAGACTCCGACTCAGGGCTCCTCCAACAGGCTTGTGACATCACGGGAGGACTGTACCTGA
AGGTGCCTCAGATGCCTTCTCTTCTGCAGTATTTGCTGTGGGTGTTTCTTCCCGATCAAG
ATCAGAGATCTCAGTTAATCCTCCCACCCCCGGTTCATGTTGACTACAGGGCTGCTTGCT
TCTGTCATCGAAATCTCATTGAAATTGGTTATGTCTGTTCTGTGTGTTTGTCAATATTCT
GCAATTTCAGCCCCATTTGTACTACGTGCGAGACAGCCTTTAAAATTTCTCTGCCTCCAG
TGCTGAAAGCCAAGAAAAAGAAACTGAAAGTGTCTGCCTGAGGATAAAATATTTTCCCCA
TCTTTTAGAGCTGTTAATAGAAATTATATAGCAGATTCTTTGTTGGGAAGACTGAAAAAA
AAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001516
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001516.3, NP_001507.2
RefSeq Size 1505 bp
RefSeq ORF 927 bp
Locus ID 2967
Cytogenetics 12q24.31
Domains Tfb4
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Basal transcription factors, Nucleotide excision repair
Gene Summary 'This gene encodes a member of the TFB4 family. The encoded protein is a subunit of the core-TFIIH basal transcription factor and localizes to the nucleus. The encoded protein is involved in RNA transcription by RNA polymerase II and nucleotide excision repair and associates with the Cdk-activating kinase complex. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 14. [provided by RefSeq, Dec 2012]'
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.