INSL3 (NM_005543) Human Untagged Clone

CAT#: SC321994

INSL3 (untagged)-Human insulin-like 3 (Leydig cell) (INSL3)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: INSL3
• Synonyms: ley-I-L; RLF; RLNL
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for SC321994 CATGGACCCCCGTCTGCCCGCCTGGGCACTGGTGCTGCTGGGCCCTGCCCTGGTGTTCGC
  GTTGGGCCCCGCGCCCACCCCAGAGATGCGTGAGAAGTTGTGCGGCCACCACTTCGTACG
  CGCGCTAGTGCGCGTGTGCGGGGGCCCCCGCTGGTCCACCGAAGCCAGGAGGCCTGCGGC
  CGGAGGCGACCGTGAGTTGCTACAGTGGCTGGAGAGACGACATCTGCTCCATGGGCTGGT
  GGCCGACAGTAATCTCACGCTGGGACCTGGCCTGCAGCCCCTGCCCCAGACCTCTCACCA
  TCACCGCCACCACCGTGCAGCTGCCACCAACCCTGCACGCTACTGCTGCCTCAGTGGCTG
  TACCCAACAAGACCTGCTGACCCTCTGTCCCTACTGATTCCTCCTTGGGTGCAGCCTCAG
  AGTGGCCTGAGGCCCAGAGGGTCTGGTCTGGTGAGCTCCTGAGGCCACACAGCACCATAA
  AGTCTCGCATCTACAGGCCTTTGATTACCTCCTGGGATGGGTGCTCACTATCTACCCCAG
  ACCAATGCCACCTGCAGCCTGTGGAGTCAACTGCAGAATAAATCACACCCTAGCCCTGGC
  TTGGAGGATCCCCGCTTTCACAGATGCTGGACACTGACAGCCAAATGTCCTCACTCCAGA
  GGAGCCCCAGACGCTCCGCTCCCTGCATGTGTAACACCCCTTCTTGCTGTCTCTTAGTAA
  ATAAACGACCCAAAGCAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_005543
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_005543.2, NP_005534.2
• RefSeq Size: 810 bp
• RefSeq ORF: 396 bp
• Locus ID: 3640
• Cytogenetics: 19p13.11
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: 'This gene encodes a member of the insulin-like hormone superfamily. The encoded protein is mainly produced in gonadal tissues. Studies of the mouse counterpart suggest that this gene may be involved in the development of urogenital tract and female fertility. This protein may also act as a hormone to regulate growth and differentiation of gubernaculum, and thus mediating intra-abdominal testicular descent. Mutations in this gene may lead to cryptorchidism. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]'
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1. Isoform 2 is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.