Peroxiredoxin 2 (PRDX2) (NM_181738) Human Untagged Clone
CAT#: SC322002
PRDX2 (untagged)-Human peroxiredoxin 2 (PRDX2), nuclear gene encoding mitochondrial protein, transcript variant 3
"NM_181738" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PRDX2 |
Synonyms | NKEFB; PRP; PRX2; PRXII; PTX1; TDPX1; TPX1; TSA |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322002
CGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGCAGCTTTCAGTCA
TGGCCTCCGGTAACGCGCGCATCGGAAAGCCAGCCCCTGACTTCAAGGCCACAGCGGTGG TTGATGGCGCCTTCAAAGAGGTGAAGCTGTCGGACTACAAAGGGAAGTACGTGGTCCTCT TTTTCTACCCTCTGGACTTCACTTTTGTGTGCCCCACCGAGATCATCGCGTTCAGCAACC GTGCAGAGGACTTCCGCAAGCTGGGCTGTGAAGTGCTGGGCGTCTCGGTGGACTCTCAGT TCACCCACCTGGCTTGGTATGAGCAGGGGCCAAAGAGGGAGGTTGCAGCTAAGCTCACAC CCTCAGGTCCTAGCAGTGTGGCTTCGTGGCCATTGCTCAACCTCTGGAACCTGCGTTTCC CCATCGTGAAAATAATGGAAACATTGCCGCCCAAGTCTTTAAGGATGATGACAGTAATTA GCATTTGACAACTAGTTGCCTGGTATATAGAGTTGCAGATGCAACTCAGATGCAACTCTA TCTACTCTATGTACTTAGTTCCCAGGAGGGAGGCTGTGCTGCCCTATTTCATGAAGATGG AAACTCCAGTTCACCGAAGTGAAGGGCTGTACCCCATGACACAGCTAGAGGAGGATGGGG ACTCTTAACACAGGCTCTCTGCTGGGTGATGCTGCAAGTTACAAGTACATGTGAAGCCAC TTAGCTGGAGCTGTGCCTCTCAAACTCAGTCTTCCCAGCCATGGGGATACAGTCCTTGCA CCCAACCCAGGGTGGGGTGGGTGAGGCTCCCAGCGGCCTACTCTAAAGCCCCTTATCTCC GGCCTCCAGTGCTTATCACATTGGGCCCACAGGGTGAGGACCCTGCTGTGCCAGGCATCC TGAGGCCCCAACTCTGTCTCCCCTACTCCCAGGATCAACACCCCCCGGAAAGAGGGAGGC TTGGGCCCCCTGAACATCCCCCTGCTTGCTGACGTGACCAGACGCTTGTCTGAGGATTAC GGCGTGCTGAAAACAGATGAGGGCATTGCCTACAGGTACTGTGGGACCCTCAGCCCGGCT CAGGGAGCGCCCTGCCCCCCATTCCTGTGATGCTGGGACCACTCCTGTACAATGTCTTCT CTGCCCCCAGCCCTGTGGCTAGCAGCGGGTGGTTGGTAGTCCCTTCCTTGTCTCTGGCAG TGGGAGCTATCAGCTCCTCACTGGGAACCCTGATGTCTTCAGGGGCCTCTTTATCATCGA TGGCAAGGGTGTCCTTCGCCAGATCACTGTTAATGATTTGCCTGTGGGACGCTCCGTGGA TGAGGCTCTGCGGCTGGTCCAGGCCTTCCAGTACACAGACGAGCATGGGGAAGTTTGTCC CGCTGGCTGGAAGCCTGGCAGTGACACGATTAAGCCCAACGTGGATGACAGCAAGGAATA TTTCTCCAAACACAATTAGGCTGGCTAACGGATAGTGAGCTTGTGCCCCTGCCTAGGTGC CTGTGCTGGGTGTCCACCTGTGCCCCCACCTGGGTGCCCTATGCTGACCCAGGAAAGGCC AGACCTGCCCCTCCAAACTCCACAGTATGGGACCCTGGAGGGCTAGGCCAAGGCCTTCTC ATGCCTCCACCTAGAAGCTGAATAGTGACGCCCTCCCCCAAGCCCACCCAGCCGCACACA GGCCTAGAGGTAACCAATAAAGTATTAGGGAAAGGTGAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_181738 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_181738.1, NP_859428.1 |
RefSeq Size | 710 bp |
RefSeq ORF | 429 bp |
Locus ID | 7001 |
Cytogenetics | 19p13.13 |
Protein Families | Druggable Genome |
Gene Summary | 'This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein plays an antioxidant protective role in cells, and it may contribute to the antiviral activity of CD8(+) T-cells. The crystal structure of this protein has been resolved to 2.7 angstroms. This protein prevents hemolytic anemia from oxidative stress by stabilizing hemoglobin, thus making this gene a therapeutic target for patients with hemolytic anemia. This protein may have a proliferative effect and play a role in cancer development or progression. Related pseudogenes have been identified on chromosomes 5, 6, 10 and 13. [provided by RefSeq, Mar 2013]' Transcript Variant: This variant (3) uses an alternative splice site, compared to variant 1, which results in a translational frameshift. The resulting protein (isoform c) has a distinct C-terminus and is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209548 | PRDX2 (Myc-DDK-tagged)-Human peroxiredoxin 2 (PRDX2), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 98.00 |
|
RG209548 | PRDX2 (GFP-tagged) - Human peroxiredoxin 2 (PRDX2), nuclear gene encoding mitochondrial protein, transcript variant 3 |
USD 460.00 |
|
RC209548L1 | Lenti ORF clone of Human peroxiredoxin 2 (PRDX2), nuclear gene encoding mitochondrial protein, transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC209548L2 | Lenti ORF clone of Human peroxiredoxin 2 (PRDX2), nuclear gene encoding mitochondrial protein, transcript variant 3, mGFP tagged |
USD 620.00 |
|
RC209548L3 | Lenti ORF clone of Human peroxiredoxin 2 (PRDX2), nuclear gene encoding mitochondrial protein, transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC209548L4 | Lenti ORF clone of Human peroxiredoxin 2 (PRDX2), nuclear gene encoding mitochondrial protein, transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review