ATP5F1C (NM_001001973) Human Untagged Clone

CAT#: SC322171

ATP5C1 (untagged)-Human ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 (ATP5C1), nuclear gene encoding mitochondrial protein, transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP5F1C
• Synonyms: ATP5C; ATP5C1; ATP5CL1
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for SC322171 CGCATGCGCGCTGAGGCCTGCCTGACCGACCTTCAGCAGGGCTGTGGCTACCATGTTCTC
  TCGCGCGGGTGTCGCTGGGCTGTCGGCCTGGACCTTGCAGCCGCAATGGATTCAAGTTCG
  AAATATGGCAACTTTGAAAGATATCACCAGGAGACTAAAGTCCATCAAAAACATCCAGAA
  AATTACCAAGTCTATGAAAATGGTAGCGGCAGCAAAATATGCCCGAGCTGAGAGAGAGCT
  GAAACCAGCTCGAATATATGGATTGGGATCTTTAGCTCTGTATGAAAAAGCTGATATCAA
  GGGGCCTGAAGACAAGAAGAAACACCTCCTTATTGGTGTGTCCTCAGATCGAGGACTGTG
  TGGTGCTATTCATTCCTCCATTGCTAAACAGATGAAAAGCGAGGTTGCTACACTAACAGC
  AGCTGGGAAAGAAGTTATGCTTGTTGGAATTGGTGACAAAATCAGAGGCATACTTTATAG
  GACTCATTCTGACCAGTTTCTGGTGGCATTCAAAGAAGTGGGAAGAAAGCCCCCCACTTT
  TGGAGATGCGTCAGTCATTGCCCTTGAATTACTAAATTCTGGATATGAATTTGATGAAGG
  CTCCATCATCTTTAATAAATTCAGGTCTGTCATCTCCTATAAGACAGAAGAAAAGCCCAT
  CTTTTCCCTTAATACCGTTGCAAGTGCTGACAGCATGAGTATCTATGACGATATTGATGC
  TGACGTGCTGCAAAATTACCAAGAATACAATCTGGCCAACATCATCTACTACTCTCTGAA
  GGAGTCCACCACTAGTGAGCAGAGTGCCAGGATGACAGCCATGGACAATGCCAGCAAGAA
  TGCTTCTGAGATGATTGACAAATTGACATTGACATTCAACCGTACCCGCCAAGCTGTCAT
  CACAAAAGAGTTGATTGAAATTATCTCTGGTGCTGCAGCTCTGGATTAATGAAAATCAAG
  TTCCATCCTCAGACAAGAGGTAAAGAAGGAAAATTCAGCCAGTTGATTTTGTTTTTAGCT
  TACTGCTGCCTTTGTCCGAAGAAACCGTTCCTCCATTATTTGAATTACTGAAGACAGCAA
  GATATTTGTAAATTATCTTAAAATAAACAACTTAAAAAAAAAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_001001973
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001001973.1, NP_001001973.1
• RefSeq Size: 1162 bp
• RefSeq ORF: 897 bp
• Locus ID: 509
• Cytogenetics: 10p14
• Protein Pathways: Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• Gene Summary: 'This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the gamma subunit of the catalytic core. Alternatively spliced transcript variants encoding different isoforms have been identified. This gene also has a pseudogene on chromosome 14. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (1) represents the longest transcript, and encodes the longest isoform (L), also known as a liver type isoform.