TGIF (TGIF1) (NM_173208) Human Untagged Clone

CAT#: SC322194

TGIF1 (untagged)-Human TGFB-induced factor homeobox 1 (TGIF1), transcript variant 3


  "NM_173208" in other vectors (4)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TGIF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TGIF1
Synonyms HPE4; TGIF
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC322194 GGAGACGTTCGCTTATCCCCTGTGTCCCCGCTCCTGGCCCCTCCAGACCCCCGCCTTGCC
TCGCGCTGGGAGGGGAGATCCAGAATGAAAGGCAAGAAAGGTATTGTTGCAGCATCTGGC
AGTGAGACTGAGGATGAGGACAGCATGGACATTCCCTTGGACCTTTCTTCATCCGCTGGC
TCAGGCAAGAGAAGGAGAAGGGGCAACCTACCCAAGGAGTCTGTGCAGATTCTTCGGGAT
TGGCTGTATGAGCACCGTTACAATGCCTATCCTTCAGAGCAAGAAAAAGCGTTGCTGTCC
CAGCAAACACACCTGTCTACGCTACAGGTCTGTAACTGGTTCATCAACGCCCGCCGCAGG
CTCCTCCCTGACATGCTGAGAAAGGATGGCAAAGATCCAAATCAGTTCACAATTTCCCGC
CGTGGGGCCAAGATTTCTGAAACGAGCTCTGTGGAGTCCGTGATGGGCATCAAAAACTTC
ATGCCAGCTCTAGAGGAGACCCCATTTCATTCCTGTACAGCTGGGCCAAACCCAACCCTA
GGGAGGCCACTGTCTCCTAAGCCGTCATCCCCGGGATCAGTTTTGGCTCGTCCATCAGTG
ATCTGCCATACCACTGTGACTGCATTGAAAGATGTCCCTTTCTCTCTCTGCCAGTCGGTC
GGTGTGGGACAAAACACAGATATACAGCAGATAGCGGCCAAAAACTTCACAGACACCTCT
CTCATGTACCCAGAGGACACTTGTAAATCTGGACCAAGTACGAATACACAGAGTGGTCTT
TTCAACACTCCTCCCCCTACTCCACCGGACCTCAACCAGGACTTCAGTGGATTTCAGCTT
CTAGTGGATGTTGCACTCAAACGGGCTGCAGAGATGGAGCTTCAGGCAAAACTTACAGCT
TAACCCATTTTCAAGCAAAACAGTTCTCAGAAATGTCATGATTGCCGGGGTGAAGGCAAG
AGATGAATTGCATTATTTTATATATTTTTTATTAATATTTGCACATGGGATTGCTAAAAC
AGCTTCCTGTTACTGAGATGTCTTCAATGGAATACAGTCATTCCAAGAACTATAAACTTA
AAGCTACTGTAGAAACAAAGGGTTTTCTTTTTTAAATGTTTCTTGGTAGATTATTCATAA
TGTGAGATGGTTCCCAATATCATGTGATTTTTTTTTCCTCCCCTTCCCTTTTTTTGTTAT
TTTTTCAGACTGTGCAATACTTAGAGAACCTATAGCATCTTCTCATTCCCATGTGGAACA
GGATGCCCACATACTGTCTAATTAATAAATTTTCCATTTTTTTTCAAACAAAAAAAAAAA
AAAAAAA
Restriction Sites Please inquire     
ACCN NM_173208
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_173208.1, NP_775300.1
RefSeq Size 1508 bp
RefSeq ORF 819 bp
Locus ID 7050
Cytogenetics 18p11.31
Protein Families Druggable Genome, Stem cell - Pluripotency, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transcription Factors
Gene Summary 'The protein encoded by this gene is a member of the three-amino acid loop extension (TALE) superclass of atypical homeodomains. TALE homeobox proteins are highly conserved transcription regulators. This particular homeodomain binds to a previously characterized retinoid X receptor responsive element from the cellular retinol-binding protein II promoter. In addition to its role in inhibiting 9-cis-retinoic acid-dependent RXR alpha transcription activation of the retinoic acid responsive element, the protein is an active transcriptional co-repressor of SMAD2 and may participate in the transmission of nuclear signals during development and in the adult. Mutations in this gene are associated with holoprosencephaly type 4, which is a structural anomaly of the brain. Alternative splicing has been observed at this locus and multiple splice variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2013]'
Transcript Variant: This variant (3) includes two alternate 5' exons, which result in a different 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (c) is shorter and has a distinct N-terminus, compared to isoform a. Variants 3, 4 and 10 encode the same isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.