C1QC (NM_172369) Human Untagged Clone
CAT#: SC322245
C1QC (untagged)-Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 2
"NM_172369" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | C1QC |
Synonyms | C1Q-C; C1QG |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322245
GGGGAAGCAGATCTGAGGACATCTCTGTGCCAGGCCAGAAACCGCCCACCTGCAGTTCCT
TCTCCGGGATGGACGTGGGGCCCAGCTCCCTGCCCCACCTTGGGCTGAAGCTGCTGCTGC TCCTGCTGCTGCTGCCCCTCAGGGGCCAAGCCAACACAGGCTGCTACGGGATCCCAGGGA TGCCCGGCCTGCCTGGGGCACCAGGGAAGGATGGGTACGACGGACTGCCGGGGCCCAAGG GGGAGCCAGGAATCCCAGCCATTCCCGGGATCCGAGGACCCAAAGGGCAGAAGGGAGAAC CCGGCTTACCCGGCCATCCTGGGAAAAATGGCCCCATGGGACCCCCTGGGATGCCAGGGG TGCCCGGCCCCATGGGCATCCCTGGAGAGCCAGGTGAGGAGGGCAGATACAAGCAGAAAT TCCAGTCAGTGTTCACGGTCACTCGGCAGACCCACCAGCCCCCTGCACCCAACAGCCTGA TCAGATTCAACGCGGTCCTCACCAACCCGCAGGGAGATTATGACACGAGCACTGGCAAGT TCACCTGCAAAGTCCCCGGCCTCTACTACTTTGTCTACCACGCGTCGCATACAGCCAACC TGTGCGTGCTGCTGTACCGCAGCGGCGTCAAAGTGGTCACCTTCTGTGGCCACACGTCCA AAACCAATCAGGTCAACTCGGGCGGTGTGCTGCTGAGGTTGCAGGTGGGCGAGGAGGTGT GGCTGGCTGTCAATGACTACTACGACATGGTGGGCATCCAGGGCTCTGACAGCGTCTTCT CCGGCTTCCTGCTCTTCCCCGACTAGGGCGGGCAGATGCGCTCGAGACCCACGGGCCTTC CACCTCCCTCAGCTTCCTGCATGGACCCACCTTACTGGCCAGTCTGCATCCTTGCCTAGA CCATTCTCCCCTCCAGGGAGCCCACCCTGACCCACCCCCACTGCACCCCCTCCCCATGGG TTCTCTCCTTCCTCTGAACTTCTTTAGGAGTCACTGCTTGTGTGGTTCCTGGGACACTTA ACCAATGCCTTCTGGTACTGCCATTCTTTTTTTTTTTTTTTCAAGTATTGGAAGGGGTGG GGAGATATATAAATAAATCATGAAATCAATACATAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_172369 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_172369.2, NP_758957.2 |
RefSeq Size | 1171 bp |
RefSeq ORF | 738 bp |
Locus ID | 714 |
Cytogenetics | 1p36.12 |
Protein Families | Secreted Protein |
Protein Pathways | Complement and coagulation cascades, Prion diseases, Systemic lupus erythematosus |
Gene Summary | 'This gene encodes the C-chain polypeptide of serum complement subcomponent C1q, which associates with C1r and C1s to yield the first component of the serum complement system. C1q is composed of 18 polypeptide chains which include 6 A-chains, 6 B-chains, and 6 C-chains. Each chain contains an N-terminal collagen-like region and a C-terminal C1q globular domain. C1q deficiency is associated with lupus erythematosus and glomerulonephritis. [provided by RefSeq, Dec 2016]' Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1-3 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC124311 | C1QC (untagged)-Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 2 |
USD 310.00 |
|
RC203832 | C1QC (Myc-DDK-tagged)-Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 2 |
USD 98.00 |
|
RG203832 | C1QC (GFP-tagged) - Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 2 |
USD 460.00 |
|
RC203832L3 | Lenti ORF clone of Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC203832L4 | Lenti ORF clone of Human complement component 1, q subcomponent, C chain (C1QC), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review