CD9 (NM_001769) Human Untagged Clone
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CD9 |
Synonyms | BTCC-1; DRAP-27; MIC3; MRP-1; TSPAN-29; TSPAN29 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322329
CGCGCCCCCCAGTCCCGCACCCGTTCGGCCCAGGCTAAGTTAGCCCTCACCATGCCGGTC
AAAGGAGGCACCAAGTGCATCAAATACCTGCTGTTCGGATTTAACTTCATCTTCTGGCTT GCCGGGATTGCTGTCCTTGCCATTGGACTATGGCTCCGATTCGACTCTCAGACCAAGAGC ATCTTCGAGCAAGAAACTAATAATAATAATTCCAGCTTCTACACAGGAGTCTATATTCTG ATCGGAGCCGGCGCCCTCATGATGCTGGTGGGCTTCCTGGGCTGCTGCGGGGCTGTGCAG GAGTCCCAGTGCATGCTGGGACTGTTCTTCGGCTTCCTCTTGGTGATATTCGCCATTGAA ATAGCTGCGGCCATCTGGGGATATTCCCACAAGGATGAGGTGATTAAGGAAGTCCAGGAG TTTTACAAGGACACCTACAACAAGCTGAAAACCAAGGATGAGCCCCAGCGGGAAACGCTG AAAGCCATCCACTATGCGTTGAACTGCTGTGGTTTGGCTGGGGGCGTGGAACAGTTTATC TCAGACATCTGCCCCAAGAAGGACGTACTCGAAACCTTCACCGTGAAGTCCTGTCCTGAT GCCATCAAAGAGGTCTTCGACAATAAATTCCACATCATCGGCGCAGTGGGCATCGGCATT GCCGTGGTCATGATATTTGGCATGATCTTCAGTACGATCTTGTGCTGTGCTATCCGCAGG AACCGCGAGATGGTCTAGAGTCAGCTTACATCCCTGAGCAGGAAAGTTTACCCATGAAGA TTGGTGGGATTTTTTGTTTGTTTGTTTTGTTTTGTTTGTTGTTTGTTGTTTGTTTTTTTG CCACTAATTTTAGTATTCATTCTGCATTGCTAGATAAAAGCTGAAGTTACTTTATGTTTG TCTTTTAATGCTTCATTCAATATTGACATTTGTAGTTGAGCGGGGGGTTTGGTTTGCTTT GGTTTATATTTTTTCAGTTGTTTGTTTTTGCTTGTTATATTAAGCAGAAATCCTGCAATG AAAGGTACTATATTTGCTAGACTCTAGACAAGATATTGTACATAAAAGAATTTTTTTGTC TTTAAATAGATACAAATGTCTATCAACTTTAATCAAGTTGTAACTTATATTGAAGACAAT TTGATACATAATAAAAAATTATGACAATGTCAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001769 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001769.2, NP_001760.1 |
RefSeq Size | 1246 bp |
RefSeq ORF | 687 bp |
Locus ID | 928 |
Cytogenetics | 12p13.31 |
Domains | transmembrane4 |
Protein Families | Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Transmembrane |
Protein Pathways | Hematopoietic cell lineage |
Gene Summary | 'This gene encodes a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Tetraspanins are cell surface glycoproteins with four transmembrane domains that form multimeric complexes with other cell surface proteins. The encoded protein functions in many cellular processes including differentiation, adhesion, and signal transduction, and expression of this gene plays a critical role in the suppression of cancer cell motility and metastasis. [provided by RefSeq, Jan 2011]' Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC119043 | CD9 (untagged)-Human CD9 molecule (CD9) |
USD 310.00 |
|
RC202000 | CD9 (Myc-DDK-tagged)-Human CD9 molecule (CD9) |
USD 98.00 |
|
RG202000 | CD9 (GFP-tagged) - Human CD9 molecule (CD9) |
USD 460.00 |
|
RC202000L1 | Lenti ORF clone of Human CD9 molecule (CD9), Myc-DDK-tagged |
USD 768.00 |
|
RC202000L2 | Lenti ORF clone of Human CD9 molecule (CD9), mGFP tagged |
USD 620.00 |
|
RC202000L3 | Lenti ORF clone of Human CD9 molecule (CD9), Myc-DDK-tagged |
USD 768.00 |
|
RC202000L4 | Lenti ORF clone of Human CD9 molecule (CD9), mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review