XBP1 (NM_005080) Human Untagged Clone
CAT#: SC322332
XBP1 (untagged)-Human X-box binding protein 1 (XBP1), transcript variant 1
"NM_005080" in other vectors (7)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | XBP1 |
| Synonyms | TREB-5; TREB5; XBP-1; XBP2 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for SC322332
GGCGCGCGGTGCGCGGTGCGTAGTCTGGAGCTATGGTGGTGGTGGCAGCCGCGCCGAACC
CGGCCGACGGGACCCCTAAAGTTCTGCTTCTGTCGGGGCAGCCCGCCTCCGCCGCCGGAG CCCCGGCCGGCCAGGCCCTGCCGCTCATGGTGCCAGCCCAGAGAGGGGCCAGCCCGGAGG CAGCGAGCGGGGGGCTGCCCCAGGCGCGCAAGCGACAGCGCCTCACGCACCTGAGCCCCG AGGAGAAGGCGCTGAGGAGGAAACTGAAAAACAGAGTAGCAGCTCAGACTGCCAGAGATC GAAAGAAGGCTCGAATGAGTGAGCTGGAACAGCAAGTGGTAGATTTAGAAGAAGAGAACC AAAAACTTTTGCTAGAAAATCAGCTTTTACGAGAGAAAACTCATGGCCTTGTAGTTGAGA ACCAGGAGTTAAGACAGCGCTTGGGGATGGATGCCCTGGTTGCTGAAGAGGAGGCGGAAG CCAAGGGGAATGAAGTGAGGCCAGTGGCCGGGTCTGCTGAGTCCGCAGCACTCAGACTAC GTGCACCTCTGCAGCAGGTGCAGGCCCAGTTGTCACCCCTCCAGAACATCTCCCCATGGA TTCTGGCGGTATTGACTCTTCAGATTCAGAGTCTGATATCCTGTTGGGCATTCTGGACAA CTTGGACCCAGTCATGTTCTTCAAATGCCCTTCCCCAGAGCCTGCCAGCCTGGAGGAGCT CCCAGAGGTCTACCCAGAAGGACCCAGTTCCTTACCAGCCTCCCTTTCTCTGTCAGTGGG GACGTCATCAGCCAAGCTGGAAGCCATTAATGAACTAATTCGTTTTGACCACATATATAC CAAGCCCCTAGTCTTAGAGATACCCTCTGAGACAGAGAGCCAAGCTAATGTGGTAGTGAA AATCGAGGAAGCACCTCTCAGCCCCTCAGAGAATGATCACCCTGAATTCATTGTCTCAGT GAAGGAAGAACCTGTAGAAGATGACCTCGTTCCGGAGCTGGGTATCTCAAATCTGCTTTC ATCCAGCCACTGCCCAAAGCCATCTTCCTGCCTACTGGATGCTTACAGTGACTGTGGATA CGGGGGTTCCCTTTCCCCATTCAGTGACATGTCCTCTCTGCTTGGTGTAAACCATTCTTG GGAGGACACTTTTGCCAATGAACTCTTTCCCCAGCTGATTAGTGTCTAAGGAATGATCCA ATACTGTTGCCCTTTTCCTTGACTATTACACTGCCTGGAGGATAGCAGAGAAGCCTGTCT GTACTTCATTCAAAAAGCCAAAATAGAGAGTATACAGTCCTAGAGAATTCCTCTATTTGT TCAGATCTCATAGATGACCCCCAGGTATTGTCTTTTGACATCCAGCAGTCCAAGGTATTG AGACATATTACTGGAAGTAAGAAATATTACTATAATTGAGAACTACAGCTTTTAAGATTG TACTTTTATCTTAAAAGGGTGGTAGTTTTCCCTAAAATACTTATTATGTAAGGGTCATTA GACAAATGTCTTGAAGTAGACATGGAATTTATGAATGGTTCTTTATCATTTCTCTTCCCC CTTTTTGGCATCCTGGCTTGCCTCCAGTTTTAGGTCCTTTAGTTTGCTTCTGTAAGCAAC GGGAACACCTGCTGAGGGGGCTCTTTCCCTCATGTATACTTCAAGTAAGATCAAGAATCT TTTGTGAAATTATAGAAATTTACTATGTAAATGCTTGATGGAATTTTTTCCTGCTAGTGT AGCTTCTGAAAGGTGCTTTCTCCATTTATTTAAAACTACCCATGCAATTAAAAGGTACAA TGCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_005080 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_005080.2, NP_005071.2 |
| RefSeq Size | 1836 bp |
| RefSeq ORF | 786 bp |
| Locus ID | 7494 |
| Cytogenetics | 22q12 |
| Domains | BRLZ |
| Protein Families | Transcription Factors |
| Gene Summary | 'This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) represents the longer transcript but encodes the shorter isoform, XBP1(U). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| SC316694 | XBP1 (untagged)-Human X-box binding protein 1 (XBP1), transcript variant 1 |
USD 420.00 |
|
| RC201959 | XBP1 (Myc-DDK-tagged)-Human X-box binding protein 1 (XBP1), transcript variant 1 |
USD 450.00 |
|
| RG201959 | XBP1 (GFP-tagged) - Human X-box binding protein 1 (XBP1), transcript variant 1 |
USD 460.00 |
|
| RC201959L1 | Lenti ORF clone of Human X-box binding protein 1 (XBP1), transcript variant 1, Myc-DDK-tagged |
USD 750.00 |
|
| RC201959L2 | Lenti ORF clone of Human X-box binding protein 1 (XBP1), transcript variant 1, mGFP tagged |
USD 750.00 |
|
| RC201959L3 | Lenti ORF clone of Human X-box binding protein 1 (XBP1), transcript variant 1, Myc-DDK-tagged |
USD 750.00 |
|
| RC201959L4 | Lenti ORF clone of Human X-box binding protein 1 (XBP1), transcript variant 1, mGFP tagged |
USD 750.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China