RPL32 (NM_001007074) Human Untagged Clone

CAT#: SC322488

RPL32 (untagged)-Human ribosomal protein L32 (RPL32), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RPL32
• Synonyms: L32; PP9932
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for SC322488 GCCATCTCCTTCTCGGCATCATGGCCGCCCTCAGACCCCTTGTGAAGCCCAAGATCGTCA
  AAAAGAGAACCAAGAAGTTCATCCGGCACCAGTCAGACCGATATGTCAAAATTAAGCGTA
  ACTGGCGGAAACCCAGAGGCATTGACAACAGGGTTCGTAGAAGATTCAAGGGCCAGATCT
  TGATGCCCAACATTGGTTATGGAAGCAACAAAAAAACAAAGCACATGCTGCCCAGTGGCT
  TCCGGAAGTTCCTGGTCCACAACGTCAAGGAGCTGGAAGTGCTGCTGATGTGCAACAAAT
  CTTACTGTGCCGAGATCGCTCACAATGTTTCCTCCAAGAACCGCAAAGCCATCGTGGAAA
  GAGCTGCCCAACTGGCCATCAGAGTCACCAACCCCAATGCCAGGCTGCGCAGTGAAGAAA
  ATGAGTAGGCAGCTCATGTGCACGTTTTCTGTTTAAATAAATGTAAAAACTGCCAAAAAA
  AAAAAAAAA
• Restriction Sites: Please inquire
• ACCN: NM_001007074
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001007074.1, NP_001007075.1
• RefSeq Size: 1787 bp
• RefSeq ORF: 408 bp
• Locus ID: 6161
• Cytogenetics: 3p25.2
• Protein Pathways: Ribosome
• Gene Summary: 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L32E family of ribosomal proteins. It is located in the cytoplasm. Although some studies have mapped this gene to 3q13.3-q21, it is believed to map to 3p25-p24. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (3) lacks a 5' exon but has an alternate segment in the 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same protein.