RPL5 (NM_000969) Human Untagged Clone

CAT#: SC322784

RPL5 (untagged)-Human ribosomal protein L5 (RPL5)


  "NM_000969" in other vectors (7)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "RPL5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPL5
Synonyms L5; MSTP030; PPP1R135; uL18
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC322784 CCTAGCGCCGCTGGGCCTGCAGGTCTCTGTCGAGCAGCGGACGCCGGTCTCTGTTCCGCA
GGATGGGGTTTGTTAAAGTTGTTAAGAATAAGGCCTACTTTAAGAGATACCAAGTGAAAT
TTAGAAGACGACGAGAGGGTAAAACTGATTATTATGCTCGGAAACGCTTGGTGATACAAG
ATAAAAATAAATACAACACACCCAAATACAGGATGATAGTTCGTGTGACAAACAGAGATA
TCATTTGTCAGATTGCTTATGCCCGTATAGAGGGGGATATGATAGTCTGCGCAGCGTATG
CACACGAACTGCCAAAATATGGTGTGAAGGTTGGCCTGACAAATTATGCTGCAGCATATT
GTACTGGCCTGCTGCTGGCCCGCAGGCTTCTCAATAGGTTTGGCATGGACAAGATCTATG
AAGGCCAAGTGGAGGTGACTGGTGATGAATACAATGTGGAAAGCATTGATGGTCAGCCAG
GTGCCTTCACCTGCTATTTGGATGCAGGCCTTGCCAGAACTACCACTGGCAATAAAGTTT
TTGGTGCCCTGAAGGGAGCTGTGGATGGAGGCTTGTCTATCCCTCACAGTACCAAACGAT
TCCCTGGTTATGATTCTGAAAGCAAGGAATTTAATGCAGAAGTACATCGGAAGCACATCA
TGGGCCAGAATGTTGCAGATTACATGCGCTGCTTAATGGAAGAAGATGAAGATGCTTACA
AGAAACAGTTCTCTCAATACATAAAGAACAGCGTAACTCCAGACATGATGGAGGAGATGT
ATAAGAAAGCTCATGCTGCTATACGAGAGAATCCAGTCTATGAAAAGAAGCCCAAGAAAG
AAGTTAAAAAGAAGAGGTGGAACCGTCCCAAAATGTCCCTTGCTCAGAAGAAGGATCGGG
TAGCTCAAAAGAAGGCAAGCTTCCTCAGAGCTCAGGAGCGGGCTGCTGAGAGCTAAACCC
AGCAATTTTCTATGATTTTTTCAGATATAGATAATAAACTTATGAACAGCAAAAAAAAAA
AAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_000969
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000969.3, NP_000960.2
RefSeq Size 1035 bp
RefSeq ORF 894 bp
Locus ID 6125
Cytogenetics 1p22.1
Domains Ribosomal_L18p
Protein Pathways Ribosome
Gene Summary 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L18P family of ribosomal proteins and component of the 60S subunit. The encoded protein binds 5S rRNA to form a stable complex called the 5S ribonucleoprotein particle (RNP), which is necessary for the transport of nonribosome-associated cytoplasmic 5S rRNA to the nucleolus for assembly into ribosomes. The encoded protein may also function to inhibit tumorigenesis through the activation of downstream tumor suppressors and the downregulation of oncoprotein expression. Mutations in this gene have been identified in patients with Diamond-Blackfan Anemia (DBA). This gene is co-transcribed with the small nucleolar RNA gene U21, which is located in its fifth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Mar 2017]'
Transcript Variant: This variant (1) represents the longer transcript and encodes the supported protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.