WNT3 (NM_030753) Human Untagged Clone

CAT#: SC322789

WNT3 (untagged)-Human wingless-type MMTV integration site family, member 3 (WNT3)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: WNT3
• Synonyms: INT4; TETAMS
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_030753, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCCCCACCTGCTCGGGCTGCTCCTCGGCCTCCTGCTCGGTGGCACCAGGGTCCTCGCTGGCTACC
  CAATTTGGTGGTCCCTGGCCCTGGGCCAGCAGTACACATCTCTGGGCTCACAGCCCCTGCTCTGCGGCTC
  CATCCCAGGCCTGGTCCCCAAGCAACTGCGCTTCTGCCGCAATTACATCGAGATCATGCCCAGCGTGGCC
  GAGGGCGTGAAGCTGGGCATCCAGGAGTGCCAGCACCAGTTCCGGGGCCGCCGCTGGAACTGCACCACCA
  TAGATGACAGCCTGGCCATCTTTGGGCCCGTCCTCGACAAAGCCACCCGCGAGTCGGCCTTCGTTCACGC
  CATCGCCTCGGCCGGCGTGGCCTTCGCCGTCACCCGCTCCTGCGCCGAGGGCACCTCCACCATTTGCGGC
  TGTGACTCGCATCATAAGGGGCCGCCTGGCGAAGGCTGGAAGTGGGGCGGCTGCAGCGAGGACGCTGACT
  TCGGCGTGTTAGTGTCCAGGGAGTTCGCGGATGCGCGCGAGAACAGGCCGGACGCGCGCTCGGCCATGAA
  CAAGCACAACAACGAGGCGGGCCGCACGACTATCCTGGACCACATGCACCTCAAATGCAAGTGCCACGGG
  CTGTCGGGCAGCTGTGAGGTGAAGACCTGCTGGTGGGCGCAGCCTGACTTCCGTGCCATCGGTGACTTCC
  TCAAGGACAAGTATGACAGCGCCTCGGAGATGGTAGTAGAGAAGCACCGTGAGTCCCGAGGCTGGGTGGA
  GACCCTCCGGGCCAAGTACTCGCTCTTCAAGCCACCCACGGAGAGGGACCTGGTCTACTACGAGAACTCC
  CCCAACTTTTGTGAGCCCAACCCAGAGACGGGTTCCTTTGGCACAAGGGACCGGACTTGCAATGTCACCT
  CCCACGGCATCGATGGCTGCGATCTGCTCTGCTGTGGCCGGGGCCACAACACGAGGACGGAGAAGCGGAA
  GGAAAAATGCCACTGCATCTTCCACTGGTGCTGCTACGTCAGCTGCCAGGAGTGTATTCGCATCTACGAC
  GTGCACACCTGCAAGTAG
  
  
• Restriction Sites: Please inquire
• ACCN: NM_030753
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_030753.3, NP_110380.1
• RefSeq Size: 1506 bp
• RefSeq ORF: 1068 bp
• Locus ID: 7473
• Cytogenetics: 17q21.31-q21.32
• Domains: wnt
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
• Gene Summary: 'The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 98% amino acid identity to mouse Wnt3 protein, and 84% to human WNT3A protein, another WNT gene product. The mouse studies show the requirement of Wnt3 in primary axis formation in the mouse. Studies of the gene expression suggest that this gene may play a key role in some cases of human breast, rectal, lung, and gastric cancer through activation of the WNT-beta-catenin-TCF signaling pathway. This gene is clustered with WNT15, another family member, in the chromosome 17q21 region. [provided by RefSeq, Jul 2008]'