CAPON (NOS1AP) (NM_001126060) Human Untagged Clone

CAT#: SC322791

NOS1AP (untagged)-Human nitric oxide synthase 1 (neuronal) adaptor protein (NOS1AP), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NOS1AP
• Synonyms: 6330408P19Rik; CAPON
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001128077, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCTACTATGGCAACTACTACGGAGGACTGGGCTATGGCTATGACTGTAAATATAGTTATACCTCTG
  GCTTTGGTGCCTTTAGAATCCTGGACTGTGGCTACAGATGTGGCTGTGGTGGGGTATGGATTTGA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_001126060
• ORF Size: 636 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001126060.1, NP_001119532.2
• RefSeq Size: 5559
• RefSeq ORF: 636
• Locus ID: 9722
• Gene Summary: This gene encodes a cytosolic protein that binds to the signaling molecule, neuronal nitric oxide synthase (nNOS). This protein has a C-terminal PDZ-binding domain that mediates interactions with nNOS and an N-terminal phosphotyrosine binding (PTB) domain that binds to the small monomeric G protein, Dexras1. Studies of the related mouse and rat proteins have shown that this protein functions as an adapter protein linking nNOS to specific targets, such as Dexras1 and the synapsins. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2009]
  Transcript Variant: This variant (2) consists of the two terminal exons of variant 1 and results in a protein (isoform 2) that is significantly shorter than isoform 1(see PMID: 16146415).